ID: 1108992851

View in Genome Browser
Species Human (GRCh38)
Location 13:56684997-56685019
Sequence CACATAATGCTTATCAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108992845_1108992851 18 Left 1108992845 13:56684956-56684978 CCAGCCTCTATCAATTTACCTTT No data
Right 1108992851 13:56684997-56685019 CACATAATGCTTATCAACAAGGG No data
1108992847_1108992851 14 Left 1108992847 13:56684960-56684982 CCTCTATCAATTTACCTTTGGCT No data
Right 1108992851 13:56684997-56685019 CACATAATGCTTATCAACAAGGG No data
1108992848_1108992851 0 Left 1108992848 13:56684974-56684996 CCTTTGGCTTCTTTAAAATGCAC No data
Right 1108992851 13:56684997-56685019 CACATAATGCTTATCAACAAGGG No data
1108992844_1108992851 26 Left 1108992844 13:56684948-56684970 CCAAAACTCCAGCCTCTATCAAT No data
Right 1108992851 13:56684997-56685019 CACATAATGCTTATCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108992851 Original CRISPR CACATAATGCTTATCAACAA GGG Intergenic
No off target data available for this crispr