ID: 1108995206

View in Genome Browser
Species Human (GRCh38)
Location 13:56722839-56722861
Sequence ACTCTTGGTGTTTTACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108995206_1108995211 29 Left 1108995206 13:56722839-56722861 CCAGAATGTAAAACACCAAGAGT No data
Right 1108995211 13:56722891-56722913 TGACTATGATGTGTCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108995206 Original CRISPR ACTCTTGGTGTTTTACATTC TGG (reversed) Intergenic
No off target data available for this crispr