ID: 1109004314

View in Genome Browser
Species Human (GRCh38)
Location 13:56851768-56851790
Sequence CTACTAATCAACATCTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109004311_1109004314 -10 Left 1109004311 13:56851755-56851777 CCACCCTAGTCAGCTACTAATCA No data
Right 1109004314 13:56851768-56851790 CTACTAATCAACATCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109004314 Original CRISPR CTACTAATCAACATCTACAT AGG Intergenic
No off target data available for this crispr