ID: 1109005284

View in Genome Browser
Species Human (GRCh38)
Location 13:56867522-56867544
Sequence AGTCATATGAAAGGTGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109005284_1109005286 5 Left 1109005284 13:56867522-56867544 CCAATCACACCTTTCATATGACT No data
Right 1109005286 13:56867550-56867572 CAACCTTTTCATTTCAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109005284 Original CRISPR AGTCATATGAAAGGTGTGAT TGG (reversed) Intergenic
No off target data available for this crispr