ID: 1109011151

View in Genome Browser
Species Human (GRCh38)
Location 13:56946403-56946425
Sequence GTCCTCTGAAACCTCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109011148_1109011151 4 Left 1109011148 13:56946376-56946398 CCCATCTATAAGGATAGTCCAAT No data
Right 1109011151 13:56946403-56946425 GTCCTCTGAAACCTCACTGATGG No data
1109011149_1109011151 3 Left 1109011149 13:56946377-56946399 CCATCTATAAGGATAGTCCAATA No data
Right 1109011151 13:56946403-56946425 GTCCTCTGAAACCTCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109011151 Original CRISPR GTCCTCTGAAACCTCACTGA TGG Intergenic
No off target data available for this crispr