ID: 1109017444

View in Genome Browser
Species Human (GRCh38)
Location 13:57036082-57036104
Sequence CTGAATTAGAACAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109017437_1109017444 11 Left 1109017437 13:57036048-57036070 CCCTAAAAGCTGGCCATTTCTTT No data
Right 1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG No data
1109017438_1109017444 10 Left 1109017438 13:57036049-57036071 CCTAAAAGCTGGCCATTTCTTTT No data
Right 1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG No data
1109017439_1109017444 -2 Left 1109017439 13:57036061-57036083 CCATTTCTTTTATAATTTCTCCT No data
Right 1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109017444 Original CRISPR CTGAATTAGAACAGGGAAAA GGG Intergenic
No off target data available for this crispr