ID: 1109017557

View in Genome Browser
Species Human (GRCh38)
Location 13:57038239-57038261
Sequence CTTATCTATCAGGATATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109017554_1109017557 27 Left 1109017554 13:57038189-57038211 CCTTGATTAACAGTTTTTCTCAC No data
Right 1109017557 13:57038239-57038261 CTTATCTATCAGGATATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109017557 Original CRISPR CTTATCTATCAGGATATAGA TGG Intergenic
No off target data available for this crispr