ID: 1109018864

View in Genome Browser
Species Human (GRCh38)
Location 13:57058624-57058646
Sequence TGGTTTGCCTAGAGTTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109018864_1109018867 14 Left 1109018864 13:57058624-57058646 CCTCTAAAACTCTAGGCAAACCA No data
Right 1109018867 13:57058661-57058683 TATCCTTTCTTTTCCTCACAGGG No data
1109018864_1109018866 13 Left 1109018864 13:57058624-57058646 CCTCTAAAACTCTAGGCAAACCA No data
Right 1109018866 13:57058660-57058682 TTATCCTTTCTTTTCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109018864 Original CRISPR TGGTTTGCCTAGAGTTTTAG AGG (reversed) Intergenic
No off target data available for this crispr