ID: 1109021920 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:57107625-57107647 |
| Sequence | GTACAGGTTGAGCAGTCCTT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1109021917_1109021920 | 18 | Left | 1109021917 | 13:57107584-57107606 | CCTTTTTCATTTCTTATATCACT | No data | ||
| Right | 1109021920 | 13:57107625-57107647 | GTACAGGTTGAGCAGTCCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1109021920 | Original CRISPR | GTACAGGTTGAGCAGTCCTT AGG | Intergenic | ||