ID: 1109021920

View in Genome Browser
Species Human (GRCh38)
Location 13:57107625-57107647
Sequence GTACAGGTTGAGCAGTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109021917_1109021920 18 Left 1109021917 13:57107584-57107606 CCTTTTTCATTTCTTATATCACT No data
Right 1109021920 13:57107625-57107647 GTACAGGTTGAGCAGTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109021920 Original CRISPR GTACAGGTTGAGCAGTCCTT AGG Intergenic