ID: 1109029468

View in Genome Browser
Species Human (GRCh38)
Location 13:57174669-57174691
Sequence TGTCTGGTTTGGCTTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109029468_1109029475 14 Left 1109029468 13:57174669-57174691 CCAGGAAAAAGCCAAACCAGACA 0: 1
1: 0
2: 2
3: 33
4: 283
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1109029468_1109029476 18 Left 1109029468 13:57174669-57174691 CCAGGAAAAAGCCAAACCAGACA 0: 1
1: 0
2: 2
3: 33
4: 283
Right 1109029476 13:57174710-57174732 GCAACAAGTGTCAGTAAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 150
1109029468_1109029471 -8 Left 1109029468 13:57174669-57174691 CCAGGAAAAAGCCAAACCAGACA 0: 1
1: 0
2: 2
3: 33
4: 283
Right 1109029471 13:57174684-57174706 ACCAGACAACCTGGAAGAAGTGG 0: 1
1: 5
2: 1
3: 61
4: 1161
1109029468_1109029473 -7 Left 1109029468 13:57174669-57174691 CCAGGAAAAAGCCAAACCAGACA 0: 1
1: 0
2: 2
3: 33
4: 283
Right 1109029473 13:57174685-57174707 CCAGACAACCTGGAAGAAGTGGG 0: 6
1: 0
2: 3
3: 27
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109029468 Original CRISPR TGTCTGGTTTGGCTTTTTCC TGG (reversed) Intergenic
907416527 1:54318241-54318263 TGCCTGGTTTGGTTTTTTGGAGG - Intronic
908295168 1:62706083-62706105 TGCCTGGTTTGGCCACTTCCTGG - Intergenic
908358741 1:63347220-63347242 TGTTTCGTTTGGCTTTTTGGGGG - Intergenic
910035114 1:82779366-82779388 TGTCTGATTTGGCTTTATGCAGG + Intergenic
910101753 1:83584803-83584825 TCTCAGGTTTGTCTTTTTCTAGG - Intergenic
910294970 1:85635417-85635439 TGTCTGCTTTGGTGTTTTCATGG + Intergenic
910432286 1:87170802-87170824 GGTATGTCTTGGCTTTTTCCTGG - Intergenic
910490930 1:87769462-87769484 TGTTTGGTTGTGCTTTTTCTAGG - Intergenic
910600067 1:89021545-89021567 TGTTTGGTTTGGTTTTTTTGGGG - Intronic
911049721 1:93660486-93660508 TGTTTGTTTTCTCTTTTTCCTGG - Intronic
911227059 1:95318052-95318074 TGTCTTGAATGGCTTTATCCAGG + Intergenic
914420632 1:147525548-147525570 AGTCTGGTATGGCTTTTTGAGGG + Intergenic
914721206 1:150290478-150290500 TGTTTTGTTTTGTTTTTTCCTGG + Intergenic
915504714 1:156346642-156346664 TGTCTGGGTTGGGTTGTGCCTGG + Intronic
915517776 1:156423082-156423104 TTTCAGGCTTGGCTTTGTCCTGG - Intronic
917617360 1:176759730-176759752 TGCCTGGTTTGGCATTCTCTGGG + Intronic
919494890 1:198251971-198251993 TGTCAGTTTTGGATCTTTCCTGG + Intronic
919498925 1:198312535-198312557 TGTCAGTTTTGGATCTTTCCTGG + Intronic
921566438 1:216727318-216727340 TGTCTTGGTTTGCTTTTTGCAGG - Intronic
923551845 1:234970401-234970423 AGTCTGGGTTGGGTTTTTCTGGG - Intergenic
924250045 1:242123609-242123631 TGTCTGTGTTGGCTTTTGCCGGG - Intronic
1063070548 10:2658839-2658861 TCTCTGTTTTGACTTCTTCCTGG + Intergenic
1063587325 10:7364318-7364340 TTTATGGTTTCCCTTTTTCCAGG + Intronic
1063881598 10:10537846-10537868 TGTCAGGTCTGTCTTTTCCCTGG - Intergenic
1064326302 10:14354526-14354548 TGACTGGGTTGGCTTATTCAGGG + Intronic
1064888288 10:20137800-20137822 TGTCTGTGTAGGCTTTTTCTGGG + Intronic
1065666039 10:28062345-28062367 TCTCTGGATTAGCTTTTTACTGG - Intronic
1066456651 10:35578025-35578047 TGTCTGGTGTGGCATTTTTCCGG + Intergenic
1067263502 10:44715265-44715287 TGGCTGGCTTGGCTCCTTCCTGG - Intergenic
1068217806 10:54006159-54006181 TCTCTGGTTTGGATTTTTATAGG + Intronic
1069410196 10:68145453-68145475 TGTCTTGTTTTTATTTTTCCAGG + Exonic
1069434498 10:68368880-68368902 TGTCTTGCTAGGCTATTTCCTGG - Intronic
1070029013 10:72658856-72658878 TGTCTGCATGGGTTTTTTCCAGG - Intergenic
1070408005 10:76113659-76113681 TGCCTTGTGTGGCTTTTACCTGG - Intronic
1072856836 10:98956296-98956318 TCTCTGGTTTGTCTTCTTCATGG - Intronic
1073827876 10:107346218-107346240 TGTTTGCTTTGCCTTCTTCCTGG + Intergenic
1074140914 10:110672110-110672132 TGTCTGGCATTGCTTTTACCCGG + Intronic
1074234328 10:111569855-111569877 TGTCATGTTTGGCTTTTTAGAGG - Intergenic
1074842276 10:117367042-117367064 GATCTGCTTTGGCTATTTCCAGG + Intronic
1076231395 10:128822681-128822703 AGTCTGGTTTGACTGTTCCCCGG - Intergenic
1079393844 11:20044727-20044749 TGGCTGGCTTTGCTTTATCCTGG + Intronic
1079828126 11:25225126-25225148 AGTCTGGTTTTGTGTTTTCCTGG + Intergenic
1080397683 11:31904980-31905002 CTCCTGGTTTGGCTTTTTCTCGG + Intronic
1083885528 11:65571779-65571801 TGTGTGGTTTGTTTTTTTCCTGG + Intronic
1087105332 11:94401868-94401890 TTTTTGGTTTGCCTTTTTCCTGG - Intergenic
1089986548 11:122819404-122819426 TGATTGGTTTGGCTTCTTCTGGG + Intergenic
1090900285 11:131025028-131025050 TGTCTATTTTGGCATTTTGCAGG + Intergenic
1092404934 12:8214320-8214342 TGTGTGGTCTGGCTGTGTCCTGG + Intergenic
1092585409 12:9896023-9896045 TTTCTGGTTTGTCTTTTCCATGG + Intergenic
1093685673 12:22051030-22051052 TGTCTGATTTGTGTTTTTCAGGG + Intronic
1096502110 12:52070335-52070357 TTTCTGGTTTTGCTTTTAGCTGG + Exonic
1096840594 12:54377408-54377430 TCTCCTGTTTGGCTTTTCCCTGG - Intronic
1097276566 12:57817652-57817674 CGGCTGGTTTGGCTTTTACCAGG - Intronic
1097342280 12:58452979-58453001 TGGCTGGTTTGGATTCCTCCAGG + Intergenic
1098533308 12:71566819-71566841 TGTCTGGTTTGTGTTTTAACAGG + Exonic
1099288192 12:80741742-80741764 TGTTTATTTTGGCTTTTTCATGG - Intergenic
1099945284 12:89236779-89236801 TGTGAGGTCTGGGTTTTTCCTGG - Intergenic
1100697221 12:97108193-97108215 TCTCTAGTTTTGCATTTTCCAGG - Intergenic
1102358043 12:112256734-112256756 TTTCTTTTTTGCCTTTTTCCAGG + Intronic
1102370770 12:112381466-112381488 GGTTTGGTTTGGTTTTTTTCCGG - Intronic
1105238554 13:18587081-18587103 TATCTGCTTTTGCTTTTGCCTGG + Intergenic
1106818967 13:33441810-33441832 TTTGTGGATTTGCTTTTTCCCGG - Intergenic
1106920400 13:34557094-34557116 TGACTGTTTTGGCTTTCGCCTGG + Intergenic
1107241342 13:38238568-38238590 TCTCTGTTTTGGCTTGATCCTGG - Intergenic
1107389585 13:39949984-39950006 TGTCTGGAATGGTATTTTCCAGG - Intergenic
1109024793 13:57143218-57143240 TGTCTGGGTTGGCTTCTTCTTGG - Exonic
1109025780 13:57149788-57149810 TGTCTGGGTTGGCTTCTTCTTGG - Exonic
1109026770 13:57156361-57156383 TGTCTGGGTTGGCTTCTTCTTGG - Exonic
1109027762 13:57162932-57162954 TGTCTGGGTTGGCTTCTTCTTGG - Exonic
1109028748 13:57169497-57169519 TGTCTGGGTTGGCTTCTTCTTGG - Exonic
1109029468 13:57174669-57174691 TGTCTGGTTTGGCTTTTTCCTGG - Intergenic
1109112875 13:58345473-58345495 GGTTTGGTTTGGTTTTTTGCTGG + Intergenic
1109895204 13:68677593-68677615 TGCCTGGTTTTACTTTTCCCTGG + Intergenic
1109992115 13:70072454-70072476 TGTCTGGTTTTGGTTTTACTGGG - Intronic
1110113222 13:71777688-71777710 TGTCTAGTTTGGATTTCTACTGG + Intronic
1110536761 13:76659462-76659484 TGTGTGGGTTTTCTTTTTCCTGG + Intergenic
1110617318 13:77555385-77555407 AGTTTGCTTTGGCTTTTTTCAGG + Intronic
1111735691 13:92136448-92136470 TTTCTGGTTTGAATTTTTTCTGG + Intronic
1111821829 13:93224635-93224657 TGTCTGGTCAGGCCTCTTCCAGG + Intergenic
1112192427 13:97191206-97191228 AGTCTGGTTGGAATTTTTCCGGG - Intergenic
1112699009 13:101982739-101982761 TGTTTGGTTTTTCTTTCTCCAGG - Intronic
1113408727 13:110065202-110065224 CGTCAGGGTTGGCTCTTTCCGGG + Intergenic
1113726827 13:112610291-112610313 TGTCTGCTTTGCCTTCTGCCAGG - Intergenic
1115739571 14:36373837-36373859 AGTTTGGTTTGCCTTTTTGCGGG + Intergenic
1115821232 14:37214647-37214669 TGTATGGCCTGGCTTTTCCCAGG - Intronic
1116445006 14:44998823-44998845 TGTCTGGTTAAGGTTATTCCTGG - Intronic
1116831800 14:49727569-49727591 TCTCTGGATTCTCTTTTTCCAGG + Intronic
1117023693 14:51598201-51598223 TTTCTGGTTTGGTTTTTTGGGGG - Intronic
1117908830 14:60616829-60616851 TTTCTCGTTTGCCTTTTTGCAGG - Intergenic
1118895528 14:69942614-69942636 ACTTTGGTTTGGCCTTTTCCAGG + Intronic
1120149232 14:81014519-81014541 TCTCAGGTTTGGCTTTCCCCTGG + Intronic
1121909673 14:97777395-97777417 TGTCTGGGTTGGCTTTTGAGAGG + Intergenic
1122204178 14:100140311-100140333 TGGCTGGTTTTGCTCTTTCAAGG - Intronic
1123675345 15:22705421-22705443 TTTCTGGTTTGGATTTTTTCTGG + Intergenic
1123688687 15:22818987-22819009 TTTCTGGTTTCTCCTTTTCCAGG + Intronic
1124327337 15:28778374-28778396 TTTCTGGTTTGGATTTTTTCTGG + Intergenic
1124529347 15:30490322-30490344 TTTCTGGTTTGAATTTTTTCTGG + Intergenic
1124662932 15:31565809-31565831 AATCTGGTTTTGCTTTCTCCTGG - Intronic
1124769312 15:32517367-32517389 TTTCTGGTTTGAATTTTTTCTGG - Intergenic
1124936243 15:34174365-34174387 TGTTTTGTTTGCCTTTCTCCAGG - Intronic
1127905299 15:63371876-63371898 GGTTTGGTTTGGTTTTTTCTTGG + Intronic
1128191044 15:65697667-65697689 TGTCTGGTTTGTCTGTGTCTTGG - Intronic
1129121358 15:73398771-73398793 GGTTTGGTTTGGTTTTTTCACGG - Intergenic
1129965118 15:79728217-79728239 TGTCTGGGTCAGCTTTTTACTGG - Intergenic
1133777833 16:8911646-8911668 TGTCTGGGTTTGCCTTCTCCGGG - Intronic
1134138545 16:11696884-11696906 TGTCTGGTTTGGGTGTGTCAGGG - Intronic
1135028910 16:19021607-19021629 TGTCCGGGTTTGTTTTTTCCAGG + Exonic
1136353876 16:29730567-29730589 TGTCTTGTTTGGCTTTTATAGGG + Intergenic
1138032628 16:53572399-53572421 TGTCTGGTTTTCCTTCTTTCAGG + Intergenic
1139518388 16:67465286-67465308 TGCCTGGTTTGGCCATCTCCCGG + Intronic
1140167621 16:72570089-72570111 AGTCTGATTTGGCTTTTCCCTGG - Intergenic
1140227145 16:73087681-73087703 TGTCAGTTTGGGCTCTTTCCAGG + Intergenic
1140677235 16:77344584-77344606 TGTGGGTTATGGCTTTTTCCTGG - Intronic
1141013742 16:80427833-80427855 TGTTTTGTTTTGTTTTTTCCTGG + Intergenic
1141135744 16:81464028-81464050 TGGCCGGGGTGGCTTTTTCCAGG + Intronic
1141453052 16:84118436-84118458 TGTTTGGTTTTGTTTTTACCAGG + Intergenic
1143200601 17:5110803-5110825 TGGCTTGTGTGTCTTTTTCCTGG - Intronic
1145230786 17:21171996-21172018 TGTTTGGTTTTGGTTCTTCCAGG + Exonic
1147303961 17:39550471-39550493 TGTCTGGTTGGGCTTGTCCCAGG + Intronic
1149237100 17:54605269-54605291 TGTCTGGTTTGGGTTTCTCCAGG - Intergenic
1150640820 17:66948343-66948365 TGTCTGGGATGGCTTTCCCCAGG + Intergenic
1151839138 17:76604996-76605018 TGTCTGTTTCGGCTGTTTCAGGG + Intergenic
1152243299 17:79171455-79171477 TGTCTGTGTTAGCTTTTGCCTGG - Intronic
1152363093 17:79841364-79841386 TGCCGTGTTTGGCTTTTTCCTGG + Intergenic
1153161336 18:2207671-2207693 TGCCTGGTGTTGCTTTCTCCAGG + Intergenic
1157135764 18:45053610-45053632 TCTCTGTTTTGTTTTTTTCCTGG - Intronic
1157636165 18:49157027-49157049 ACTCTGGTTTGGCTTATTTCTGG + Intronic
1158265039 18:55652264-55652286 TGTTTTGTTTTGTTTTTTCCTGG + Intronic
1161591938 19:5132902-5132924 TGTCTGGTTTGGGTTTTCAGAGG + Intronic
1161994413 19:7703671-7703693 TGCCTGGTTTGCCTTGTCCCTGG + Intergenic
1162179548 19:8858641-8858663 TGCCTGGCTGGGCTTTGTCCTGG + Exonic
1167422119 19:49410024-49410046 TGTCTGGTCTGGCTTGTGGCTGG - Intronic
925477831 2:4238435-4238457 TGTCTGGAGTGGCATTTTCTAGG - Intergenic
926610890 2:14945309-14945331 TGGCTTGTTTTGTTTTTTCCTGG - Intergenic
926731200 2:16037052-16037074 TGTCTGGTTTGACTTTTGCCTGG - Intergenic
927205949 2:20610419-20610441 TCTGTGGTTTTGCTTTTTCCAGG + Intronic
927416948 2:22889933-22889955 TGTTTGAATTAGCTTTTTCCAGG - Intergenic
927726486 2:25427784-25427806 TGTCTGTTTTGCCTACTTCCTGG + Intronic
928137938 2:28702620-28702642 TTTCAGCTTTGGCTCTTTCCTGG - Intergenic
928680365 2:33695002-33695024 AGTCTGGTTTTGCATTTACCTGG + Intergenic
931353790 2:61516302-61516324 TGTTTGGTTTGGTTTTTTCGAGG - Intronic
932433089 2:71686980-71687002 TGTCTGGTTTGCCTTAGCCCCGG + Intergenic
932513184 2:72316442-72316464 TATTTGGTTTTGCCTTTTCCAGG + Intronic
933068608 2:77831367-77831389 TGCCTGGTTGGCCTTCTTCCAGG + Intergenic
933396009 2:81732097-81732119 TTTCTGGTTTGTCTTTCTCTAGG - Intergenic
933697898 2:85233776-85233798 CCTCTGGTTTTGCCTTTTCCAGG + Intronic
933832103 2:86219383-86219405 TGTTTTGTTTTGGTTTTTCCAGG - Intronic
935177716 2:100664148-100664170 TGTCAGGTTAGCCTCTTTCCCGG - Intergenic
935974750 2:108567201-108567223 TGTCTGCTTGGGTTTTCTCCTGG + Intronic
936272461 2:111059742-111059764 TGTGTGCGTTAGCTTTTTCCAGG - Intronic
936979247 2:118249203-118249225 TGTGTGTTTTTGCTTTCTCCAGG + Intergenic
939101545 2:137900071-137900093 TCTATGGTTTTGCTTTTTGCTGG + Intergenic
939910564 2:147977789-147977811 TGGATGGTTTGGCTTTCTCTGGG + Intronic
940117697 2:150227300-150227322 TGTCTGCGTGGGCTTTCTCCAGG + Intergenic
940802555 2:158148961-158148983 TTTTTGGTTATGCTTTTTCCTGG - Intergenic
941266556 2:163370130-163370152 TGTTTGTTTTGGTTTTTACCTGG + Intergenic
941404348 2:165070198-165070220 TTTCTGGTCTGGCTTTGTCTTGG + Intergenic
941584499 2:167340575-167340597 TCTCTCCTTTGCCTTTTTCCTGG - Intergenic
942601839 2:177648528-177648550 AATCTGGTTTGTCTTTTTACTGG - Intronic
943382488 2:187169719-187169741 TGTCTGGTTTAGGGTTTTCCTGG - Intergenic
944421983 2:199541307-199541329 TGTCTAGTTTGGGTTTCTCTTGG + Intergenic
945843832 2:214919426-214919448 AGTTTGGTTTGTCTTTTTCAAGG - Intergenic
947371111 2:229446485-229446507 TATCTGGTTTGGCTTGACCCTGG - Intronic
947390563 2:229635178-229635200 TGGATGCTCTGGCTTTTTCCTGG + Intronic
947638536 2:231693173-231693195 TTTCAGGCTTGGCTCTTTCCTGG + Intergenic
948075861 2:235164824-235164846 TCTCAGGTTTGACTCTTTCCTGG - Intergenic
948386062 2:237581820-237581842 AGACTTGTTGGGCTTTTTCCAGG - Intronic
948983023 2:241504521-241504543 TGTCAGCTTTGAATTTTTCCTGG - Intronic
1169295574 20:4394387-4394409 TGTATGGCCTGGCTTTTTCTAGG + Intergenic
1169350131 20:4862085-4862107 GGTCTGGTTTGTTTTTCTCCAGG - Exonic
1169509789 20:6251135-6251157 TGTTTTGTTTTGTTTTTTCCAGG - Intergenic
1170447902 20:16448558-16448580 TGTTTGCTTTTGCTTTTGCCTGG - Intronic
1170908588 20:20540608-20540630 TTTCTAGTTTGTGTTTTTCCAGG + Intronic
1174942152 20:54940877-54940899 TGTCAGTTTTGGTTTTTCCCTGG + Intergenic
1175654608 20:60759114-60759136 TGTATGGTTGGGCTTATTTCTGG - Intergenic
1175913394 20:62414994-62415016 TCTCTGGCTTGGCTTTTTCTGGG - Intronic
1176782545 21:13215361-13215383 TATCTGCTTTTGCTTTTGCCTGG + Intergenic
1177689934 21:24492902-24492924 TGTTTTGTTTTGTTTTTTCCTGG + Intergenic
1177849054 21:26324817-26324839 TGTCTACTTTACCTTTTTCCTGG + Intergenic
1178030614 21:28521300-28521322 TGTCTGGTAAGACCTTTTCCAGG - Intergenic
1178818515 21:35953673-35953695 TGTCTGCTTTGGAATTTTCTGGG - Intronic
1183179688 22:36251708-36251730 TGACTTGTGTGACTTTTTCCTGG + Intergenic
1184574155 22:45348726-45348748 TGTTTTGTTTTGTTTTTTCCTGG + Intronic
1184802249 22:46768536-46768558 TGTCTGGGCTGGTTCTTTCCCGG + Intronic
1184969553 22:48005957-48005979 TTTCTTGTTTTACTTTTTCCTGG + Intergenic
950260718 3:11542006-11542028 AGGCTTGTTTGCCTTTTTCCAGG - Intronic
950268468 3:11593565-11593587 TGTTTTGTTTTGTTTTTTCCTGG - Intronic
951980939 3:28566005-28566027 TGCCTGGTTTTGCTATTACCAGG + Intergenic
952341220 3:32449255-32449277 TGTCTTGCTTGGCCTCTTCCTGG + Intronic
952851719 3:37734952-37734974 TGACTTGTTGGGCTTTCTCCAGG - Intronic
955592521 3:60552885-60552907 TGTCTGGATGGGTTTTCTCCAGG + Intronic
956035654 3:65088460-65088482 TTTCTGGTTTTTCTTTTTCAGGG + Intergenic
956177838 3:66490148-66490170 TGGGTGGTTTGGCCTTATCCAGG - Intronic
957140640 3:76350909-76350931 TGTCCCGATTGTCTTTTTCCAGG - Intronic
957437098 3:80192208-80192230 TTTCTGGTGAGGATTTTTCCTGG + Intergenic
957766920 3:84637380-84637402 TATCTGGTATGTCATTTTCCTGG - Intergenic
958057717 3:88434593-88434615 GGTTTGGTTTGGATTTTTTCTGG - Intergenic
958874077 3:99595772-99595794 TGTCTGTTTTGTGTTTTGCCAGG + Intergenic
959912001 3:111773949-111773971 AGGCCAGTTTGGCTTTTTCCTGG - Intronic
959976455 3:112466215-112466237 TGCCTGGTTTGTTTTCTTCCAGG + Exonic
962436147 3:135368604-135368626 CTTCTGGGTTGGCTTTTGCCTGG - Intergenic
962763342 3:138538537-138538559 TGGCTTGTTTGGGTTTTTCTTGG - Intronic
964027635 3:152096969-152096991 TGTCTGGTTTGGCATTGTAAAGG + Intergenic
964496915 3:157301365-157301387 TGTTTTGTTTTGTTTTTTCCTGG + Intronic
966020992 3:175210113-175210135 TTGCTTGTTTGGCTTTTTCTTGG - Intronic
966574671 3:181486767-181486789 TGTCTGGTTCTGTTTTTTTCAGG + Intergenic
967420010 3:189262295-189262317 TGACTGGATTGGGTTTTTTCTGG + Intronic
967487484 3:190050505-190050527 TGTCAGGTTTTGTTTTTTTCTGG + Intronic
968073752 3:195804535-195804557 TGTTTGTCTTGGGTTTTTCCTGG + Intronic
969459167 4:7318937-7318959 TGTATAGTTTTGCCTTTTCCAGG + Intronic
969999566 4:11351402-11351424 TTTCTGTTTTTGCTTTTTACAGG - Intergenic
970604974 4:17671115-17671137 AGTCTGGTTTTGCATTCTCCTGG - Intronic
970756684 4:19435738-19435760 TGTTTGGTTTTGCTTTGCCCAGG + Intergenic
971263155 4:25075391-25075413 AGTCTGTTCTGGCTTCTTCCCGG + Intergenic
971795879 4:31227752-31227774 TGTCTGTTTTTGCTATTTCTTGG + Intergenic
972593621 4:40511082-40511104 TGGCTGGTTTTGCTTTTTGCAGG - Intronic
973017550 4:45160052-45160074 TATCTGTTTTCTCTTTTTCCTGG + Intergenic
973868142 4:55135570-55135592 TGACCAGTTTGCCTTTTTCCTGG + Intergenic
974313539 4:60245888-60245910 TCTCTTTTCTGGCTTTTTCCAGG - Intergenic
974702486 4:65469945-65469967 TGGCTATTTTGGCTTTTTCTGGG - Intronic
975581790 4:75913365-75913387 TGACTGGTGTTTCTTTTTCCCGG + Intergenic
975606818 4:76163258-76163280 TCTTTGGTTTGGTTTTTACCTGG - Exonic
975626669 4:76356589-76356611 TGTGTGGTTTGGCCCTTTGCTGG - Intronic
975859394 4:78660079-78660101 TGTCTGGTTTGGGATATTCCTGG + Intergenic
977246432 4:94637060-94637082 TGTCTGGTGTGGCATGTTCAAGG + Intronic
977706254 4:100074129-100074151 TCTCCAGTTTGGCCTTTTCCAGG + Intergenic
978116695 4:105027054-105027076 TGTCTTTTTTGTCTTTTTGCAGG - Intergenic
978272611 4:106908842-106908864 TGTGTGTTTGGGGTTTTTCCAGG + Intergenic
980316462 4:131207897-131207919 TGTCTGCTTGGCCCTTTTCCAGG + Intergenic
981191477 4:141869970-141869992 TCTGTGGCTTGTCTTTTTCCTGG + Intergenic
981305253 4:143240349-143240371 TGTCTGCATGGGCTTTCTCCAGG - Intergenic
981536874 4:145809356-145809378 TGGCTGCCTTTGCTTTTTCCTGG + Intronic
981952434 4:150424727-150424749 TGTCTGTGTGGGCTTTTTCCAGG - Intronic
982458645 4:155640237-155640259 TGTTTTGTTTTGTTTTTTCCCGG - Intergenic
983277783 4:165639227-165639249 TTTCTGGTTTTGGTATTTCCTGG - Intergenic
984362966 4:178761007-178761029 TGACTGGTTTGAGTTTTTACCGG - Intergenic
985219149 4:187684147-187684169 TTTCTAGTTTGCATTTTTCCAGG - Intergenic
985729390 5:1538877-1538899 TGTCTGGTGAGGCTGTATCCTGG + Intergenic
988016373 5:25564912-25564934 TGTGTGGATTGGCTTTTTGCAGG + Intergenic
989395822 5:40955291-40955313 TCCATAGTTTGGCTTTTTCCAGG + Intronic
990127799 5:52539710-52539732 TGTCTGGTTTGTTTTTATTCTGG - Intergenic
992046031 5:72890629-72890651 TGTTTGGTTTGGCTTTTGTGGGG + Intronic
993108379 5:83626005-83626027 TTTCTGGTTTTCCTTTTTGCTGG + Intergenic
993801550 5:92349395-92349417 TTTCTGATTTGGCTTTTGCCTGG + Intergenic
994134267 5:96266695-96266717 TGGCTTGTTTGGGTTTTTACTGG - Intergenic
994243725 5:97454435-97454457 TTACTGCTTTGGCTTTTCCCTGG - Intergenic
994926195 5:106120328-106120350 TGTCAGGATTGGCTTTTACTAGG - Intergenic
995669604 5:114586914-114586936 TGTTTGTTTTGGCTTTTTATCGG - Intergenic
997031990 5:130140983-130141005 TGTCTAGTTTGGCATTTCCAAGG - Intronic
997166066 5:131661010-131661032 TGACTGGTTTGGCTTCTTAAGGG + Intronic
997665157 5:135624779-135624801 TGGCTGGCTTGGCATTTTCTTGG + Intergenic
998208904 5:140178922-140178944 TGTTTGGCTTTGTTTTTTCCTGG + Intronic
1000802071 5:165740034-165740056 AATTTGGTATGGCTTTTTCCAGG - Intergenic
1001285758 5:170422561-170422583 TGTCTGGTTTATCTGTTTCAGGG + Intronic
1001951709 5:175820984-175821006 TCTCTGGTTTGGGCTCTTCCTGG + Intronic
1002382015 5:178837767-178837789 TGCCTAGTTTTGCCTTTTCCAGG - Intergenic
1002648767 5:180675920-180675942 TGCCTAGTTTTGCCTTTTCCAGG + Intergenic
1003265578 6:4562510-4562532 TGTCTGGTCAGGCTATTCCCAGG - Intergenic
1004727373 6:18324246-18324268 TGTCTGGTTTAACATTTTCCTGG - Intergenic
1005086598 6:22013734-22013756 TGTTTGGGGTGGCTTATTCCAGG + Intergenic
1005797894 6:29386988-29387010 AGAGTGGTTTGACTTTTTCCAGG - Intronic
1010876203 6:81109565-81109587 TCTGTAGTTTTGCTTTTTCCAGG + Intergenic
1010935819 6:81860113-81860135 TGTCTGGATTGGGTGATTCCTGG - Intergenic
1012248288 6:96951988-96952010 TGTCTGCATGGGTTTTTTCCAGG + Intronic
1012320334 6:97836931-97836953 AGTTTGCTTTGGCTTTTTCAAGG - Intergenic
1012455839 6:99404567-99404589 TTTCTGGTTTTGCTTTTCCTGGG - Intronic
1014368847 6:120579879-120579901 TGCCTTGTTTGGCATTTTTCAGG + Intergenic
1015843204 6:137494346-137494368 TCTCTGGTTAGGCTGCTTCCTGG + Intergenic
1018483924 6:164220580-164220602 TCTCTGGTGTAGCTGTTTCCAGG - Intergenic
1019302713 7:316197-316219 TGTCTGGTTTGGGTTATTTTAGG + Intergenic
1021519923 7:21528847-21528869 TGACTGGTTTGGATTTTGCCAGG - Intergenic
1023286646 7:38627940-38627962 TGTCTGGTTTCTCTTTTGCGTGG - Intronic
1025042824 7:55662757-55662779 AGTCTGGCTGGGCATTTTCCTGG - Intergenic
1025840673 7:65142838-65142860 CGTCCGTTTTGGCTTTCTCCCGG + Intergenic
1025878038 7:65507325-65507347 CGTCCGTTTTGGCTTTCTCCCGG - Intergenic
1028808577 7:95058332-95058354 TGTTTTGTTTTGTTTTTTCCAGG - Intronic
1029046934 7:97639790-97639812 AGTCTGGTTGGAGTTTTTCCAGG + Intergenic
1030246195 7:107386727-107386749 TGTCTAGCATGCCTTTTTCCAGG - Intronic
1033818405 7:145103298-145103320 TGTTTGGTTTTGTTTTTTCCTGG - Intergenic
1036271292 8:7305505-7305527 TGTGTGGTCTGGCTGTGTCCTGG - Intergenic
1037601778 8:20402585-20402607 TGTCTGCTGTAGGTTTTTCCTGG - Intergenic
1037644250 8:20775888-20775910 TGTTTTGTTTTGTTTTTTCCTGG - Intergenic
1038082133 8:24150325-24150347 TGGCTGGATTGGCATTTGCCTGG + Intergenic
1038349600 8:26763828-26763850 TATCTGTTTTGACTTTTTGCAGG - Intronic
1038678227 8:29643063-29643085 TGTCTGGCTTCCCTTTCTCCTGG - Intergenic
1039672225 8:39614130-39614152 TGTCTCGTATAGCATTTTCCTGG - Intronic
1046267571 8:111850248-111850270 TTTCAGGTTTTGCTTTTTTCTGG + Intergenic
1046564882 8:115886280-115886302 TGTGTAGTTTAGCATTTTCCTGG + Intergenic
1046681214 8:117172230-117172252 GTTCTGTCTTGGCTTTTTCCAGG + Intronic
1046702286 8:117414916-117414938 CATCTGGTGTGGCATTTTCCTGG - Intergenic
1047234555 8:123028474-123028496 TGACTGCTTTGGCTTTTTTAGGG + Intronic
1047545993 8:125817503-125817525 TATCTGGTTTGGATATTTCTAGG + Intergenic
1048173847 8:132133884-132133906 TGTCTTCTCTGGCTTTGTCCTGG + Intronic
1048193570 8:132312377-132312399 TCTCTGTTTTGACTTTTCCCTGG - Intronic
1049625902 8:143620664-143620686 TGTCTGGTGTGGCCACTTCCTGG + Intergenic
1051600078 9:18863710-18863732 TTTCTGGTTTGGCATTCTCTTGG - Intronic
1052195010 9:25701502-25701524 TGTTTTGTTTTGCTTTTTACTGG - Intergenic
1059429013 9:114238966-114238988 GGTCTGCTTTGGCCCTTTCCTGG + Intronic
1061445511 9:130635090-130635112 TGTCTGGTTGGTCTGTTTGCCGG - Intronic
1186315558 X:8365691-8365713 TGCATGGTTTGTCTTTTGCCTGG + Intergenic
1186870926 X:13771545-13771567 CTTGTGGTTTGGCTGTTTCCTGG - Exonic
1187590254 X:20709877-20709899 TTTTTGGGGTGGCTTTTTCCAGG + Intergenic
1187753097 X:22489010-22489032 TGGCCTGTTTGGCTTTTTCTGGG + Intergenic
1187820695 X:23284933-23284955 TGTTTGCTATGGTTTTTTCCTGG - Intergenic
1189527205 X:41836013-41836035 TGTCTGTTTTGAATTTTTTCAGG - Intronic
1189920501 X:45898683-45898705 AGTCACGTTTGCCTTTTTCCAGG + Intergenic
1190512386 X:51186185-51186207 TGACTGGTGTGGCTTTCTCCAGG - Intergenic
1190627820 X:52353635-52353657 TCTCTGGCTTGACTCTTTCCAGG - Intergenic
1192977035 X:76297706-76297728 TGTCTGGATTGGATTGCTCCAGG + Intergenic
1193371589 X:80704769-80704791 TGTCTGGTTTGTCTTTTTGGGGG + Exonic
1194227192 X:91275441-91275463 TGTCTGGTTGGTCTCTTTCATGG - Intergenic
1195334653 X:103839593-103839615 TGACTGGTCTGGCAGTTTCCTGG + Intergenic
1195948142 X:110237590-110237612 GGTCTGGTTTGCCTTTTACAAGG + Intronic
1198540595 X:137635182-137635204 CTTCTGGTTTGGCTTTTTCTGGG + Intergenic
1198979427 X:142378221-142378243 TTTCTGGTTTGCATTTTTCCAGG + Intergenic
1200022344 X:153222526-153222548 TGTCTTGTTGGACTTTTTCCAGG + Intergenic
1200147328 X:153933181-153933203 TGCATGGTTTTGCCTTTTCCAGG - Intronic
1200916737 Y:8577887-8577909 AGTCATGTATGGCTTTTTCCTGG + Intergenic
1200963636 Y:9016999-9017021 AGTCACGTTTGGCTTTTGCCTGG - Intergenic