ID: 1109029470

View in Genome Browser
Species Human (GRCh38)
Location 13:57174680-57174702
Sequence TTCTTCCAGGTTGTCTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 5, 2: 0, 3: 18, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109029470_1109029476 7 Left 1109029470 13:57174680-57174702 CCAAACCAGACAACCTGGAAGAA 0: 1
1: 5
2: 0
3: 18
4: 195
Right 1109029476 13:57174710-57174732 GCAACAAGTGTCAGTAAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 150
1109029470_1109029475 3 Left 1109029470 13:57174680-57174702 CCAAACCAGACAACCTGGAAGAA 0: 1
1: 5
2: 0
3: 18
4: 195
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109029470 Original CRISPR TTCTTCCAGGTTGTCTGGTT TGG (reversed) Intergenic
906108200 1:43307133-43307155 TTCCTCCAGGTTGTGGGGCTGGG + Exonic
906875642 1:49535483-49535505 ATCTTTTAAGTTGTCTGGTTTGG - Intronic
907741119 1:57166859-57166881 TTCTTCCTGGCTGTCTGACTTGG - Intronic
909563644 1:77031691-77031713 CTCTCCCAGGTTTTCTGTTTGGG - Intronic
909783735 1:79583458-79583480 TTCTTCCAGGTTATCCAATTTGG + Intergenic
911252574 1:95594263-95594285 TTCTTCTAGGTTTTCTAGTTTGG + Intergenic
911775761 1:101810006-101810028 TTCTTCCATGTTGTCATGGTTGG - Intronic
915051413 1:153078111-153078133 TTCTTCCAATTTGTGTTGTTGGG - Intergenic
915053301 1:153100858-153100880 TTCTTCCAATTTGTATTGTTGGG - Intronic
915148801 1:153812341-153812363 CACCTCCAGGTTTTCTGGTTAGG - Intronic
915800955 1:158792977-158792999 TTCTTCCTTTTTGTCTGATTGGG + Intergenic
915868735 1:159534756-159534778 ATCTTTGAGCTTGTCTGGTTAGG - Intergenic
916615280 1:166432896-166432918 TTCCTCCAGCTTCCCTGGTTAGG - Intergenic
919608046 1:199710559-199710581 CTCTTCCAGGGTCTGTGGTTTGG - Intergenic
921653462 1:217706322-217706344 TTCTTCTATGTGGTATGGTTTGG + Intronic
922344083 1:224681610-224681632 ATCTTCCTGCTTGTCTGGCTTGG + Intronic
1064374137 10:14780277-14780299 TTCTTCCAAGTAGTCCTGTTTGG - Intergenic
1065761052 10:28983624-28983646 TTATTCCAGATTATCTGGGTGGG - Intergenic
1066314288 10:34228393-34228415 TTCTTCCAGCTTTTATGTTTTGG - Intronic
1066359180 10:34713962-34713984 TTCTTCCAGGTTGGTTGTTTTGG - Intronic
1068133924 10:52931764-52931786 TTCATCCAAGTTTTCTGCTTTGG - Intergenic
1070480272 10:76875495-76875517 TGCTTCCAGATTGCCTTGTTAGG + Intronic
1072269736 10:93764626-93764648 TTCTTCCTAGTTGTATGATTTGG + Intronic
1072467291 10:95677704-95677726 CTCTTTCAGGTTATCTGCTTAGG - Intronic
1073357294 10:102867192-102867214 TTCCTCCATGGTGTCTGGTGTGG - Intronic
1074858846 10:117494119-117494141 TTATCCCAGGATATCTGGTTTGG - Intergenic
1075292131 10:121239966-121239988 TTCTTTCAAGTGGTTTGGTTAGG - Intergenic
1080179342 11:29405074-29405096 TTTTTCCAGGTAGTCTTGTTTGG + Intergenic
1080807139 11:35663533-35663555 TTCTTCTTGGTTGTCTTCTTCGG - Exonic
1083339655 11:61950845-61950867 TATTTCCAGGTTGGATGGTTGGG + Intronic
1085743222 11:79094480-79094502 CTTTTCCAGGATGTCAGGTTTGG + Intronic
1086790664 11:91034040-91034062 TTCTTCCTGGTTGTCTTGGGAGG + Intergenic
1090527703 11:127555447-127555469 TTCTTCCAGAGTTTCTGGTGAGG - Intergenic
1091279141 11:134372109-134372131 TTCTGCAAGGATGTCTGCTTGGG + Intronic
1095935541 12:47676678-47676700 TTCTTCCTGGTTGTCTTGGGAGG - Intronic
1096227756 12:49877342-49877364 CACTTCCAGGTTGTCTGGGTGGG + Intronic
1097288132 12:57893369-57893391 CTCTTCCAGGGTCTCTGGGTGGG - Intergenic
1098188366 12:67922444-67922466 TTTCTCCAGGTTGTTTTGTTTGG - Intergenic
1098881041 12:75917824-75917846 TAATTCCAGGTAGTCTGATTAGG + Intergenic
1099640347 12:85278167-85278189 GAATGCCAGGTTGTCTGGTTTGG + Intergenic
1100658721 12:96674565-96674587 TTTTTCCTGGTTGTCTAATTAGG - Intronic
1102789584 12:115633664-115633686 TTCTTCCTGGTGGTGTGGATAGG - Intergenic
1106015176 13:25862563-25862585 CTCTTCCAGGTGCTTTGGTTTGG - Intronic
1106536947 13:30654181-30654203 TTCTTCCATGCTGTCAGGGTTGG - Intronic
1106985145 13:35338045-35338067 TTCTTCTAGTTTGTCCTGTTGGG - Intronic
1107005705 13:35608666-35608688 TTCATTCAGTTTGACTGGTTTGG - Intronic
1109024795 13:57143229-57143251 TTCTTCCAGGTTGTCTGGGTTGG - Exonic
1109025782 13:57149799-57149821 TTCTTCCAGGTTGTCTGGGTTGG - Exonic
1109026772 13:57156372-57156394 TTCTTCCAGGTTGTCTGGGTTGG - Exonic
1109027764 13:57162943-57162965 TTCTTCCAGGTTGTCTGGGTTGG - Exonic
1109028750 13:57169508-57169530 TTCTTCCAGGTTGTCTGGGTTGG - Exonic
1109029470 13:57174680-57174702 TTCTTCCAGGTTGTCTGGTTTGG - Intergenic
1110339018 13:74367206-74367228 TTCTTCCAGGCAGTGTGCTTGGG - Intergenic
1112473949 13:99714232-99714254 CTCTTCCTGGTTGTTTGTTTCGG + Intronic
1113326963 13:109291615-109291637 GTCTTCCAAGATCTCTGGTTAGG + Intergenic
1113678524 13:112225456-112225478 GTCTTCCAGGTCGTGTGGTCTGG - Intergenic
1116899164 14:50345470-50345492 TGCTTCAAGGCTGTCTGTTTGGG - Intronic
1117455951 14:55896938-55896960 TTCTACCAGGCTGTCTGCCTTGG + Intergenic
1120448719 14:84637735-84637757 TTCTTGTAGGTTTTCTAGTTTGG + Intergenic
1125330120 15:38574073-38574095 TTTTTCCTAGGTGTCTGGTTGGG + Intergenic
1128925445 15:71651149-71651171 TTCTTTCAGGTTGTCAGGCCAGG + Intronic
1128979484 15:72175996-72176018 TTCCTCCAGGAGCTCTGGTTCGG + Intronic
1130449816 15:84040079-84040101 CTGTTTCAGGTTGTCTGTTTGGG - Intergenic
1133846489 16:9458802-9458824 TTCATCCAGGTAATCTGCTTGGG + Intergenic
1134312924 16:13092708-13092730 TTTTTCCAGGTAGTCTGTTGTGG + Intronic
1141526636 16:84616167-84616189 TGCTTCCTGGCTGTGTGGTTTGG - Intronic
1146403975 17:32521630-32521652 TTAATCCAGGTTGGCTGGCTAGG - Intronic
1147609695 17:41794198-41794220 TACTTCCAGGTTCTCTGTTGGGG - Intergenic
1149733070 17:58965345-58965367 TTCTTTTTGGTTGTCTGGTATGG - Intronic
1150964253 17:69949527-69949549 TTCTTTCAGCTGGTTTGGTTTGG - Intergenic
1151922095 17:77164534-77164556 TGCTTCCAGGTTGTCCAGCTGGG + Intronic
1152556869 17:81057756-81057778 TTCTCCCAGCTTGTCTGGGCAGG + Intronic
1152900913 17:82940595-82940617 TTCCGCGAGGTTTTCTGGTTTGG + Intronic
1152938488 17:83153837-83153859 TCCTTCCCGGATGTCTGATTTGG + Intergenic
1153466402 18:5392788-5392810 TTCTTCCTTGTTGTTTGCTTTGG - Exonic
1154122184 18:11660917-11660939 TTGTTCCAGTTTGTGTGGGTGGG - Intergenic
1154293898 18:13133361-13133383 TTCTGCCACGTTTTGTGGTTGGG + Intergenic
1156191896 18:34729832-34729854 TTCTTTCAGATTGTCTGCTTTGG - Intronic
1156255531 18:35392260-35392282 TTATTCTGGGTTGTCTGGTTGGG + Intergenic
1156486072 18:37466517-37466539 AACTTCCAGGATGTCTGCTTAGG + Intronic
1159498794 18:69241415-69241437 TTCTCTCAGGTGGTCTTGTTTGG - Intergenic
1161663681 19:5562198-5562220 CTCTTTCAGGTAGTCTGGGTTGG - Intergenic
1163557315 19:18000107-18000129 TTCTACCCTGTTGTCTGGCTGGG + Intergenic
1165572417 19:36786461-36786483 TTCTGCCATGTTGCCTGGGTTGG + Intergenic
1165861423 19:38911451-38911473 TTCCTCCAGGTAGCCTGGGTGGG + Intronic
1166554697 19:43690447-43690469 CTCTTCCAGTTTCTTTGGTTTGG + Intergenic
1167468643 19:49663447-49663469 CTCTTCCAGGTTGGCAGGTCTGG + Exonic
924997380 2:374716-374738 TTGTTTCAGGTTGGCTGGTGTGG - Intergenic
927653699 2:24928144-24928166 TTGTTCCAGGAAGGCTGGTTGGG + Intergenic
928277603 2:29917202-29917224 TTCTTCCATGTTTTGTGGTGAGG - Intronic
928926048 2:36580269-36580291 TTCTTTCAGATGGTCTGATTTGG - Intronic
929108258 2:38385045-38385067 TTTTGCCATGTTGCCTGGTTTGG - Intergenic
930512741 2:52366402-52366424 TTCTTCTAAGTTGTCTGATCAGG + Intergenic
932337568 2:70939644-70939666 TTCTTCTAGGCTGTTTGGTTTGG - Exonic
933663320 2:84945119-84945141 TGACTCCAGGTTTTCTGGTTTGG - Intergenic
935585204 2:104794599-104794621 TCCATCCAGGTTCTCTGTTTGGG + Intergenic
936609943 2:113992384-113992406 TTTTTCCTGTTTGTCAGGTTTGG - Intergenic
939148613 2:138446516-138446538 TTCTTCCAAGTAGTTTGGGTAGG - Intergenic
939810702 2:146828397-146828419 TTAGTCCAGATTGTCTGTTTAGG - Intergenic
940400996 2:153247944-153247966 TTCTTCCAGATTTTTTAGTTTGG - Intergenic
940993613 2:160123018-160123040 TTCTCCCAGGTTGTCTCTGTTGG + Intronic
941247338 2:163116014-163116036 TTATTCCAAGTGGTATGGTTTGG + Intergenic
941308547 2:163900597-163900619 TCCCTCTAGGTTTTCTGGTTTGG - Intergenic
941953790 2:171183997-171184019 TTATCCCAGATTGTCTGGGTGGG + Intronic
942016887 2:171826810-171826832 TTCTGCCAGGTTGTAAGGTAAGG + Exonic
944332985 2:198494288-198494310 TTCTCCCAGGTTCTCTGTTATGG - Intronic
945180184 2:207083743-207083765 TTATTCTGGATTGTCTGGTTGGG + Intronic
945770307 2:214034663-214034685 TGCTTTCAGGATGTCTGGTCTGG - Intronic
946021405 2:216642830-216642852 GTCTTCCAGGTTGGCTGGCCAGG - Intronic
947663349 2:231886626-231886648 CTCTTCCAGGTTCTCTGGCTGGG + Intergenic
948056459 2:235012439-235012461 TTCTTCCTGGTTGTCATGTTTGG + Intronic
1168789454 20:566400-566422 TTCTTCCATGTTGTGAAGTTGGG + Intergenic
1168828472 20:830642-830664 TTCTGCCATGTTGTCTAGATTGG + Intergenic
1169682913 20:8236697-8236719 ATATTCCAGTTTGTTTGGTTCGG - Intronic
1170072025 20:12379712-12379734 TCCTTCTAGGTTTTTTGGTTGGG + Intergenic
1173629120 20:44496953-44496975 GTCTTGCGGGTTATCTGGTTGGG - Intronic
1173888435 20:46481965-46481987 TTCTCCTGGGTTGTCTGGGTGGG + Intergenic
1178353492 21:31891059-31891081 CACTTCCATTTTGTCTGGTTGGG - Intronic
1179196465 21:39168341-39168363 TTCCTCTAGGTTTTCTAGTTTGG + Intergenic
949264011 3:2135981-2136003 TTCATCCTGGTTGTAGGGTTGGG + Intronic
953245402 3:41186420-41186442 TCCTTTCAGTTTGTCTGCTTTGG + Intergenic
953817202 3:46168821-46168843 TTCTTTCAGGATCTCTGGTAAGG + Intronic
954189102 3:48943537-48943559 TTGTTCCAGGTTCTTGGGTTTGG + Intronic
955068471 3:55552614-55552636 TTTTTCCAAATTCTCTGGTTGGG - Intronic
955949336 3:64226321-64226343 TTCTTCCAGATTGCTTGGTTAGG - Intronic
956339711 3:68208775-68208797 TTCCTCCAAGTTGTATGCTTGGG + Intronic
957733283 3:84171066-84171088 ATCTTACAGGTTGTCTGCATAGG + Intergenic
958454043 3:94307902-94307924 TTTTCCCATGGTGTCTGGTTAGG + Intergenic
958677876 3:97290639-97290661 TTATCCTAGGTTTTCTGGTTTGG + Intronic
958796578 3:98712586-98712608 ATCTTACAGGTTATCTAGTTTGG - Intergenic
958855357 3:99377522-99377544 GGCTTCCAGGTGGTTTGGTTGGG - Intergenic
959713909 3:109412246-109412268 TTTTTGCATGTTGTCTGTTTTGG - Intergenic
960179952 3:114564220-114564242 TTATGCCAGATTATCTGGTTAGG - Intronic
960887658 3:122412989-122413011 TAATTCCAGGGTTTCTGGTTTGG - Exonic
960955798 3:123029639-123029661 AGCTTCCAATTTGTCTGGTTGGG + Intergenic
962971218 3:140403793-140403815 TTTTTCCAGGCTGTCTCGTGGGG - Exonic
963825308 3:149946578-149946600 TTCTTCTAGATTATCTGGTTTGG + Intronic
963895324 3:150679517-150679539 TCCTTACAGGCTGTCTGATTCGG - Intronic
963998039 3:151734100-151734122 TTCTTCAATGTTGTCTGGCATGG - Exonic
965097318 3:164248799-164248821 CTCTTTCAGGTTGTCTACTTTGG - Intergenic
965792295 3:172402681-172402703 TTCTTCCAAGTTGTTGGTTTTGG - Intergenic
967258108 3:187613746-187613768 TGATTCCAGGTTGGCTGGTCTGG + Intergenic
967591289 3:191276816-191276838 TTCTTCCAGTTTGTTAGGTAAGG + Exonic
975253634 4:72209789-72209811 TTCTTCCATGTTCTTTGGTCTGG - Intergenic
976232910 4:82864670-82864692 TTCATCCAGATTATCTGTTTAGG - Intronic
977129432 4:93216935-93216957 TTCTTCCAGGGTGCTTTGTTGGG + Intronic
977735166 4:100405983-100406005 TTCTTTTAGGTTTTCTGGTTTGG + Intronic
978603240 4:110450317-110450339 GTCTTCCAGGTCAGCTGGTTGGG + Intronic
981498911 4:145425523-145425545 TTCTTTCATGTTTTCTGCTTGGG + Intergenic
981786878 4:148489446-148489468 TTCTTCCAGTTCCTCAGGTTAGG + Intergenic
982168317 4:152636648-152636670 CTCTTCAAGCTTGTCTTGTTAGG - Intronic
982248637 4:153381428-153381450 CTTTTCAAGGTTGTCTGATTTGG - Intronic
982269234 4:153569620-153569642 TTTAGCCAGGTGGTCTGGTTTGG - Intronic
983280601 4:165676578-165676600 TTATTCCAGGTTATCTGGGTAGG + Intergenic
984137153 4:175955074-175955096 TTCTTCCAGGTATTGTGTTTTGG - Intronic
984465787 4:180099415-180099437 TTCTTCTTGGTTTTCTAGTTTGG + Intergenic
985547991 5:519646-519668 TGCTTCCTTGTTGTCTGGGTGGG - Intronic
986628226 5:9743107-9743129 TCTTCGCAGGTTGTCTGGTTGGG - Intergenic
987459574 5:18192237-18192259 TGGTGCCAGGTTGTCTAGTTGGG + Intergenic
988085455 5:26469699-26469721 TTCTTCCAGGTTTTCCCTTTTGG + Intergenic
988481222 5:31632521-31632543 TATTTCCAGGTGGTCTGATTAGG + Intergenic
989554082 5:42771652-42771674 TTCTTCTAGGTTATCCAGTTTGG - Intronic
990826899 5:59910498-59910520 TTCTTGCATTTTGTCTGGTTTGG - Intronic
990901777 5:60758763-60758785 TTCTTCCAGATTGTCGTCTTAGG - Intronic
993358289 5:86941705-86941727 TTCTTCCAGGTAGTCTGTCACGG + Intergenic
994328869 5:98482419-98482441 TTCTGCCAGGTTCTCTGCTTAGG - Intergenic
994344667 5:98669980-98670002 TTCTTCCACTTTGTCAGTTTTGG - Intergenic
996216722 5:120876513-120876535 TTCTCCCAGGTCATGTGGTTGGG - Intergenic
996695806 5:126393617-126393639 TGCTTCCAGGTTGACTTATTTGG - Intronic
998003652 5:138643270-138643292 TTCTTCCCAGTTGTCTTCTTCGG + Intronic
998179520 5:139926769-139926791 TTCTTTCCTGTTGTCTTGTTTGG + Intronic
1000943779 5:167395368-167395390 TTCTAACAGGTTGTGGGGTTGGG + Intronic
1001124765 5:169009499-169009521 TTCTTCATGGGTGTCTGGGTGGG - Intronic
1003418009 6:5930295-5930317 TTCATCCAGCTTCTGTGGTTAGG + Intergenic
1006533267 6:34675680-34675702 TTCCTCCAGTTTGTCTCGCTTGG - Intronic
1007750851 6:44070454-44070476 TGCTTCCAGTTTTTCAGGTTTGG + Intergenic
1011590170 6:88963872-88963894 TTTCTCTAGGTTGTCTGGATGGG - Intergenic
1014951493 6:127560905-127560927 TTGTTCAAGGTTGTTTTGTTTGG - Intronic
1015481473 6:133715733-133715755 TTATTCTAGGTTGTCTGAGTAGG - Intergenic
1017469784 6:154728067-154728089 TTCTCTCAGGATGCCTGGTTTGG + Intergenic
1017722970 6:157257042-157257064 TGCCTCCTGGTTGTCTGGATGGG - Intergenic
1018808350 6:167278487-167278509 TTCTTCCTGATTGTCAGGTGAGG - Intronic
1020428331 7:8094577-8094599 TTATTGCAGGTTGTTTGGTCTGG + Intergenic
1024024438 7:45399241-45399263 TCCTTCCAAGTTGGCGGGTTGGG + Intergenic
1028131623 7:87182126-87182148 TTCTTCCCATTTGACTGGTTTGG - Intronic
1029625175 7:101716283-101716305 TTCTTCCAGGCTGTCTTGACTGG - Intergenic
1030993223 7:116326609-116326631 TTTTTCCATCTTGTTTGGTTTGG + Intronic
1033275522 7:139968651-139968673 TTCTTCCAAATCGTCTTGTTTGG + Intronic
1034125875 7:148671191-148671213 TTATTCCAGATTGCCTGGGTGGG + Intergenic
1035008015 7:155684204-155684226 CTCTTTGAGGTTGTCTGCTTTGG + Intronic
1035247524 7:157573562-157573584 TTCTTAAAGGGTATCTGGTTTGG - Intronic
1035780808 8:2226974-2226996 TGCTTTCTGGTTTTCTGGTTTGG - Intergenic
1038066118 8:23965424-23965446 TTCTTCCTGGATGTCTATTTTGG - Intergenic
1038873320 8:31520009-31520031 TTTTTCCAGGTAGTCTGTCTCGG + Intergenic
1039699677 8:39949248-39949270 TTCTTCCAGATTCTCTGGTAAGG + Exonic
1042671029 8:71263392-71263414 ATGTTCCAGGTTGCTTGGTTTGG - Intronic
1044864257 8:96554686-96554708 TTGATCCAGGTTATCTGATTTGG + Intronic
1046458416 8:114501262-114501284 TTCTTCCAGGTTTTCAGTTTTGG + Intergenic
1046489928 8:114938088-114938110 CTCTTCCAGGTTTACTTGTTTGG + Intergenic
1048399822 8:134054496-134054518 GGCTTCCAGTTTGTGTGGTTTGG - Intergenic
1048439319 8:134448285-134448307 TTATTCCAGGTAATCTGGATGGG - Intergenic
1049425144 8:142534706-142534728 GTTTTCCTGCTTGTCTGGTTGGG - Intronic
1050818700 9:9849777-9849799 TTCTTAGAGGCTTTCTGGTTTGG - Intronic
1051337165 9:16076426-16076448 TTCTTCCAGGTTGATTGTGTGGG + Intergenic
1051861523 9:21630477-21630499 TTATTCTAGGTTTTCTAGTTTGG - Intergenic
1055443217 9:76357057-76357079 TTTTTCCAGGTGGTATGATTTGG - Intronic
1059107481 9:111524246-111524268 TTGTTCTAGGTTGTGTGTTTAGG - Intergenic
1061565816 9:131439118-131439140 CTTTTCCAGAATGTCTGGTTGGG + Intronic
1186293077 X:8121209-8121231 TGCTTCCAGCTTCTCTGGGTGGG - Intergenic
1186908713 X:14138837-14138859 TTCTGCCATGTTGTCTAGGTTGG - Intergenic
1188162980 X:26824925-26824947 ATCTTCCAGGTTGGATGCTTTGG + Intergenic
1190099951 X:47515000-47515022 TTGTTCCATGTGGTCTGGGTGGG - Intergenic
1191838595 X:65492066-65492088 GTGTTCCGGGTGGTCTGGTTTGG - Intronic
1193154116 X:78155204-78155226 TTCTTCTAGATTTTCTAGTTTGG + Intergenic
1193191906 X:78580865-78580887 TTTTTCTAGTTTGTTTGGTTAGG - Intergenic
1195025297 X:100870801-100870823 TTTCTCTAGGTTGTTTGGTTAGG - Exonic
1196725570 X:118892208-118892230 TATTTCCAGGATTTCTGGTTGGG - Intergenic
1196973279 X:121132547-121132569 TTTTGCCAGGTTGGCTGGTTTGG + Intergenic
1197029793 X:121799845-121799867 TTCTTCCTGGTTGTCTTGGGAGG + Intergenic