ID: 1109029472

View in Genome Browser
Species Human (GRCh38)
Location 13:57174685-57174707
Sequence CCCACTTCTTCCAGGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 6, 1: 0, 2: 1, 3: 14, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109029472_1109029476 2 Left 1109029472 13:57174685-57174707 CCAGACAACCTGGAAGAAGTGGG 0: 6
1: 0
2: 1
3: 14
4: 190
Right 1109029476 13:57174710-57174732 GCAACAAGTGTCAGTAAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 150
1109029472_1109029475 -2 Left 1109029472 13:57174685-57174707 CCAGACAACCTGGAAGAAGTGGG 0: 6
1: 0
2: 1
3: 14
4: 190
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109029472 Original CRISPR CCCACTTCTTCCAGGTTGTC TGG (reversed) Intergenic
900558058 1:3289898-3289920 CCCACTCCCTCCAGGGTGCCAGG + Intronic
900608950 1:3536383-3536405 TCCAGCTCTTCCAGGTTGTGGGG - Intronic
900792860 1:4691288-4691310 CCACCTTCTCCCAGGTTGGCTGG + Intronic
901971253 1:12910991-12911013 CCCACCACTTACAGGCTGTCTGG + Intronic
902949798 1:19873455-19873477 CCCACTTCTTACAAGCTGTGTGG - Intergenic
903015607 1:20359735-20359757 CCAACTTGTTCCAGGTTGACTGG - Intergenic
903231358 1:21924253-21924275 CCAATTTCTTCCAGGATGTCTGG - Intronic
903231493 1:21925053-21925075 CCAATTTCTTCCAGGAGGTCTGG + Intronic
903259536 1:22123930-22123952 CCCACATCTTCCAGGCTTTCTGG - Intronic
904154508 1:28471606-28471628 TCCACTTCTTACAGGTCATCTGG + Intronic
907282963 1:53362850-53362872 CCCAGTTCTTCAGAGTTGTCAGG - Intergenic
908111563 1:60903624-60903646 CCCTCCTCTTCCAGGCTGTGAGG + Intronic
909674160 1:78220540-78220562 CCCACATCTTCCAGGTGAGCCGG - Intergenic
909914849 1:81304017-81304039 CACCCTTCTTTCTGGTTGTCAGG + Intergenic
909996529 1:82286760-82286782 CCCAATTCATGCAGGCTGTCTGG + Intergenic
910559773 1:88577903-88577925 CACACTTCTTACAGAATGTCGGG - Intergenic
912407411 1:109452296-109452318 CCTAATTCTTCCTGGTTGTGAGG - Intergenic
914921592 1:151851096-151851118 CCGACTTCTTCTGGGTTGGCTGG + Exonic
915639513 1:157212850-157212872 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
916686078 1:167148211-167148233 CCCCCTTCTTCAGGGTTTTCTGG + Intergenic
916955853 1:169833773-169833795 CCCACTTCTTCTAAGATATCTGG - Intronic
920124240 1:203680984-203681006 CCCACTTCTTCCAGGCTTGGAGG + Intronic
922710675 1:227828640-227828662 CCTTCTTCATCCAGATTGTCTGG - Intronic
1064933626 10:20655024-20655046 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
1071167905 10:82828267-82828289 CTCACTTATTCCTGGGTGTCCGG - Intronic
1072465268 10:95656867-95656889 CCCGCCTCTTCCAGGCTGCCGGG - Intergenic
1073582412 10:104680747-104680769 CCCATGACTTCCAGGTTCTCTGG + Intronic
1074666753 10:115736708-115736730 GTCACTTCTTCCAGGGTCTCTGG + Intronic
1077177356 11:1196863-1196885 CTCTCTCCTTCCAGGGTGTCTGG + Intronic
1077445863 11:2590527-2590549 CCCTCATCTTCCAGGTGGTGGGG + Intronic
1078486130 11:11725099-11725121 CCCAGTTCCTCCAGGCTGTCAGG - Intergenic
1080391515 11:31851514-31851536 CCCAAGTGTTCCATGTTGTCTGG - Intronic
1080520601 11:33065056-33065078 CCAACTCCTCCCAGTTTGTCTGG - Intronic
1083009618 11:59384399-59384421 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
1084063436 11:66690098-66690120 TCCGCTTCTTCAAGGCTGTCCGG - Exonic
1085015884 11:73173836-73173858 CCCACTGCTTCCTGGTGGGCAGG + Intergenic
1087687318 11:101279730-101279752 TCCTCTTCTTCCTGCTTGTCTGG - Intergenic
1088185302 11:107160114-107160136 CCCAATTTTTCCAGGTGGGCTGG - Intergenic
1088365690 11:109037675-109037697 CCCAGTTCTTACAAGTTGTTTGG + Intergenic
1088416744 11:109597493-109597515 CACACTTCTTTCCCGTTGTCTGG - Intergenic
1088557248 11:111074475-111074497 CCTTCTTCTCCCAGGTTGTTGGG - Intergenic
1089373166 11:117975996-117976018 ACCACTTCTTCCAACCTGTCAGG - Intergenic
1089696949 11:120221811-120221833 TCCAGTTCTTCCAGGTAGGCTGG + Intronic
1089823077 11:121246317-121246339 CCCACTCCTTCCAAGTTGGCGGG + Intergenic
1092861924 12:12725708-12725730 CCCACTTCTTCCCCATTGGCCGG + Intergenic
1096227752 12:49877337-49877359 CACGCCACTTCCAGGTTGTCTGG + Intronic
1097218803 12:57434783-57434805 CACACTTCTTCCAGGGCCTCTGG + Exonic
1099738615 12:86601730-86601752 ACCACTTCTTCCCGGTTGGGTGG - Intronic
1105672384 13:22633811-22633833 TCCACTTCTTCTAGATTTTCTGG + Intergenic
1106473234 13:30076394-30076416 CCCACTTCTTCCTTGGTTTCTGG - Intergenic
1106967159 13:35084970-35084992 TCCATTTCTTCTAGGTTTTCTGG - Intronic
1107420614 13:40242790-40242812 GGCACTTCTTCCAGCTTGACTGG - Intergenic
1107448782 13:40490238-40490260 CCAACTTCTTCCAGGTCCCCTGG + Intergenic
1109024798 13:57143234-57143256 CCCACTTCTTCCAGGTTGTCTGG - Exonic
1109025785 13:57149804-57149826 CCCACTTCTTCCAGGTTGTCTGG - Exonic
1109026775 13:57156377-57156399 CCCACTTCTTCCAGGTTGTCTGG - Exonic
1109027767 13:57162948-57162970 CCCACTTCTTCCAGGTTGTCTGG - Exonic
1109028753 13:57169513-57169535 CCCACTTCTTCCAGGTTGTCTGG - Exonic
1109029472 13:57174685-57174707 CCCACTTCTTCCAGGTTGTCTGG - Intergenic
1110854612 13:80282656-80282678 GCCATTTCTTCTAGGTTCTCTGG + Intergenic
1112537937 13:100279040-100279062 CCCACTTCTCACCGGTGGTCTGG + Intronic
1113457363 13:110458174-110458196 CCCACTTCCTCCAGGTCCTGCGG - Intronic
1113612539 13:111657472-111657494 CACACATCTTACAGGATGTCTGG - Intronic
1114080805 14:19200410-19200432 CCCACTTCTTCCAGAGGGCCTGG + Intergenic
1114359503 14:21955784-21955806 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
1117014378 14:51503985-51504007 TCCACTTCTTCTAGATTTTCTGG + Intronic
1117351542 14:54886137-54886159 AGGACTTCTCCCAGGTTGTCAGG - Intronic
1118532222 14:66718956-66718978 CACACGTCCTTCAGGTTGTCAGG + Intronic
1122281345 14:100624270-100624292 CTCCCTTCTTCCAGGCTGGCGGG + Intergenic
1123696354 15:22881699-22881721 CACACCTCTTCCTGGTTGTAAGG + Intronic
1128696881 15:69772443-69772465 TCCATTTCTTCTAGGTTTTCTGG - Intergenic
1130171892 15:81523396-81523418 CCCAATTCTTCCAGGATGCTGGG - Intergenic
1132699641 16:1216809-1216831 CCACCTTCTTCCAGGTGCTCCGG - Intronic
1134659993 16:15976879-15976901 CCTACTACTTCCAGGCTGTGTGG - Intronic
1136617744 16:31408914-31408936 CCCTCTCCTTCCAGGCTGCCTGG - Intronic
1142206211 16:88784445-88784467 CCGCCTTCTCCCAGATTGTCAGG + Intronic
1142621832 17:1170161-1170183 CCCAGTGCTTCCAGGATGCCTGG + Intronic
1143052767 17:4140254-4140276 CAGACTTCTTCCAGATTCTCTGG + Intronic
1146597058 17:34178592-34178614 CACTCTGCTTCCAGGTTTTCAGG + Intergenic
1147563438 17:41522487-41522509 CCCACTTCTTCCTGGTGGAGAGG - Intronic
1148159524 17:45442038-45442060 CCCACCCCTTCCCGGCTGTCGGG + Intronic
1150940214 17:69684930-69684952 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
1152280650 17:79383242-79383264 CCTCCTTCACCCAGGTTGTCCGG + Intronic
1156448370 18:37253319-37253341 CCCAGTTCTTCCAGGAGGGCTGG - Intronic
1156470485 18:37374624-37374646 CCCACGTCTTCCAGAGTGCCTGG - Intronic
1156620834 18:38849649-38849671 CCCAATTCTCCCAGGTTATAGGG - Intergenic
1158518745 18:58152701-58152723 TCCATTTCTTCCAAGTTGCCAGG + Intronic
1159782786 18:72678487-72678509 CCCACTCCTTCCATAGTGTCAGG + Intergenic
1160534814 18:79586149-79586171 CCCACCTCTCCCGGGGTGTCTGG + Intergenic
1160931121 19:1569859-1569881 CCCACTTCTTCCAGGCAGGCAGG + Intergenic
1164773136 19:30828050-30828072 CCCACTTCTTTCCTGTTGGCAGG + Intergenic
1166530014 19:43536687-43536709 CCCACTTCTTACAAGTTGCCAGG + Intergenic
1168072349 19:53960137-53960159 CCCTCTTATCCCAGGTTGTTAGG + Intergenic
1168342257 19:55631763-55631785 CCTGCTTCTTCCAGGTTCTAAGG + Intergenic
927355518 2:22168524-22168546 CCCATTTCGTCTAGGTTTTCTGG - Intergenic
927462392 2:23310404-23310426 CCCACTTCTTCCTTCTTGTCTGG + Intergenic
927913785 2:26921175-26921197 CCCAATTATTTCATGTTGTCAGG + Intronic
928059725 2:28099370-28099392 CACACTACAACCAGGTTGTCAGG - Intronic
928697218 2:33861528-33861550 CCTACTTCTTTCTGGTTGTGAGG + Intergenic
929501070 2:42492655-42492677 CCCACTCCTACCCCGTTGTCCGG - Intronic
936694290 2:114928466-114928488 ACCTCTTCTTCCAGTGTGTCAGG - Intronic
939132700 2:138256817-138256839 TCCATTTCTTCCAGATTTTCTGG - Intergenic
940903156 2:159145421-159145443 CCCACCTCCTACAGGTTGTGAGG - Intronic
942146722 2:173034405-173034427 CCGTCTTCTTCCTGGGTGTCTGG - Intronic
942458413 2:176152927-176152949 CCCACTTCTATAAGGTCGTCAGG - Exonic
943320260 2:186435965-186435987 CCCACAGCTTGCAGGTTGTATGG - Intergenic
945392800 2:209285085-209285107 TCCATTTCTTCCAGATTTTCTGG - Intergenic
945737895 2:213624092-213624114 TTAACTTCTACCAGGTTGTCAGG - Intronic
946239621 2:218345617-218345639 CCTCCTTCTTCCAGGCTGTAGGG - Exonic
947076422 2:226350447-226350469 CTCACTGCTTTCAGGGTGTCAGG - Intergenic
949039629 2:241841907-241841929 CCCAGCTCTTCCAGGAAGTCTGG - Intergenic
1169290056 20:4341794-4341816 TCCACATTTTCCAGGCTGTCTGG - Intergenic
1169853106 20:10074861-10074883 CCCACTGCTTCCAGCATCTCAGG - Intergenic
1170043995 20:12066194-12066216 CCCACTTCTTCCAAGCTGATGGG - Intergenic
1171004759 20:21453637-21453659 CCCACCTCTTCCAGAAAGTCAGG + Intergenic
1171185662 20:23122494-23122516 CACACTCCTGCCAGGTTGTGGGG - Intergenic
1172332715 20:34086781-34086803 AGCACTTCTTCCAGACTGTCTGG + Intronic
1172663861 20:36585901-36585923 CCCATTACTTCCTGGCTGTCAGG + Intronic
1173499982 20:43546097-43546119 CCCACTCCTTCCACTCTGTCTGG - Intronic
1173524556 20:43721753-43721775 CCCACCCCTTCCAAGTTGGCGGG - Intergenic
1175171382 20:57083915-57083937 CCCACTGTATCCAGGCTGTCTGG + Intergenic
1176271354 20:64236541-64236563 GCCTCTGCTTCCAGTTTGTCAGG + Exonic
1178160012 21:29901532-29901554 TCCACTTCTTCTAGATTTTCTGG - Intronic
1179099132 21:38341444-38341466 CCCACACCTTCCAGATTATCTGG + Intergenic
1180499968 22:15922275-15922297 CCCACTTCTTCCAGAGGGCCTGG - Intergenic
1181032768 22:20156302-20156324 CCCGTTTCTCCCAGGTTTTCTGG - Intergenic
1181143875 22:20829409-20829431 TCCATTTCTTCTAGGTTTTCTGG + Intronic
1182066666 22:27435960-27435982 CGCACTTCTTCCCGGCTGCCTGG + Intergenic
1183303604 22:37070483-37070505 CCCACTGCTTCCAGGAGGACAGG - Exonic
1183351265 22:37336033-37336055 CCCATCTCTTCCAGGGTGGCTGG + Intergenic
1183476299 22:38037944-38037966 CTCACTTCATGCAGGTTGGCCGG + Intronic
1183720938 22:39560913-39560935 CCCACATCTTCCTGGATATCAGG - Intergenic
1184220512 22:43096955-43096977 CCGACTTCCTCCAGATTGCCTGG + Intergenic
1185421422 22:50736718-50736740 CTCACCTCTTCCTGGTTGTCTGG - Intergenic
952405805 3:33004098-33004120 GTCACTTCTTCCACGTTGTTTGG - Intronic
952662804 3:35871910-35871932 CCCACTTCTTACAGAAAGTCCGG - Intergenic
953919724 3:46943529-46943551 CCTACTTCTGCCAGGTGGTTCGG - Intronic
954933926 3:54309496-54309518 TCCACCACTTCCAGATTGTCAGG - Intronic
957685833 3:83502540-83502562 CCCACAGCTTGCAGGTTGTTTGG + Intergenic
961118282 3:124350446-124350468 CCCAAGTCATCCAGCTTGTCAGG + Intronic
962909122 3:139831749-139831771 CCCAGTTGTCCCAGTTTGTCTGG + Intergenic
963070796 3:141303730-141303752 CCAACTTGTTCCAGTTTGCCTGG - Intergenic
964549503 3:157871057-157871079 CCAACTTGTCCCAGTTTGTCTGG - Intergenic
968065458 3:195756432-195756454 TCCCCTTCTGCCAGGTTGGCAGG - Intronic
969210464 4:5683451-5683473 CCCACTTGGTCCATGTTTTCTGG - Intronic
972628285 4:40821663-40821685 CCCACTTCTTTCAGGAGTTCTGG + Intronic
973781262 4:54290189-54290211 CCCACATCTTCCAGGTAGTTTGG + Intronic
977050068 4:92118721-92118743 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
977369986 4:96123733-96123755 CACAGTTCTTCCAGGTTATCAGG + Intergenic
978090482 4:104708679-104708701 CCCAACTCTTCCAGCTTGTAAGG - Intergenic
980494644 4:133575325-133575347 TCAACTTCCTCCAGGTTATCAGG - Intergenic
981273360 4:142869525-142869547 CTCACTTCTTCTAGCTTGTAGGG - Intergenic
982265243 4:153532909-153532931 CCTGCTTCTTCCAGGTTACCAGG - Intronic
983906873 4:173192487-173192509 CCTACTTCTGAAAGGTTGTCTGG + Intronic
985581103 5:695596-695618 CCCACCTCTTCCAGCTTCTGTGG + Intergenic
985595727 5:786928-786950 CCCACCTCTTCCAGCTTCTGTGG + Intergenic
988959816 5:36358659-36358681 CCAACTTCTTCCAGGAACTCAGG - Intergenic
991092484 5:62706462-62706484 CCCACTTCTTTCAGGATGAGAGG + Intergenic
991108670 5:62871663-62871685 TACAGTTCTTACAGGTTGTCTGG - Intergenic
992016521 5:72580682-72580704 TCCACTTCTTCTAGATTTTCTGG - Intergenic
992306990 5:75450793-75450815 CCCACCCCTTCCAAGTTTTCTGG + Intronic
996648549 5:125845627-125845649 CCCAATTCTTTCAGGATGCCGGG + Intergenic
997351252 5:133233021-133233043 ACCACTCCTTCCAGGTGGTATGG - Intronic
999062540 5:148652188-148652210 CCCACTGCTACCACGTTATCAGG - Intronic
999131139 5:149284235-149284257 CCCAGTCCTTACAGGTTGTGCGG + Intronic
999944323 5:156578668-156578690 TCCACTTCTTCTAGATTTTCTGG + Intronic
1001033178 5:168277593-168277615 CTCCCTTCTTCCAGGTGGTGGGG - Intergenic
1004766139 6:18729641-18729663 TCCATTTCTTCTAGGTTTTCTGG - Intergenic
1006059860 6:31411783-31411805 CCCAGTTCTTCCAGGCTGGCAGG - Intronic
1006096512 6:31659787-31659809 CCCACATCTTCCATGGTTTCTGG + Exonic
1007273626 6:40657587-40657609 TCAGCTTCTTCCAGGTTTTCTGG - Intergenic
1009510428 6:64544758-64544780 TCCATTTCTTCTAGGTTTTCTGG - Intronic
1010031748 6:71278446-71278468 CCAACTCCTCCCAGCTTGTCAGG - Intergenic
1020162836 7:5785344-5785366 CTCCCTCCTTCTAGGTTGTCTGG + Intergenic
1021789279 7:24185334-24185356 TCCATTTCTTCTAGGTTTTCTGG + Intergenic
1022616684 7:31938408-31938430 CCCACCCCTTCCAGCTTATCTGG - Intronic
1024209562 7:47191990-47192012 GTGACTTCTTCCTGGTTGTCTGG - Intergenic
1024998204 7:55291680-55291702 TCCATTTCTTCTAGATTGTCTGG + Intergenic
1026925017 7:74185437-74185459 CCCACTTCTCCCATCTTTTCGGG - Intronic
1029344462 7:99968263-99968285 CCCACTTCTGCTTGGTTATCTGG + Exonic
1029350980 7:100012652-100012674 CCCACTCCTTCCAAGTTGGAGGG + Intergenic
1035719842 8:1783756-1783778 CCCATTTCATTCAAGTTGTCCGG - Exonic
1037070312 8:14638196-14638218 CCAACTTTTTTCAGTTTGTCAGG + Intronic
1037698066 8:21245198-21245220 GCCACTTCTTCCAGTTTTTCAGG + Intergenic
1038314999 8:26476859-26476881 CCCACTGCTTCCTGGCTGTGTGG - Intronic
1039855007 8:41404310-41404332 CCCACTTCTTCCGTGTGGTGTGG - Intergenic
1039886697 8:41658491-41658513 CCTCCTGCTTCCAGGTTGTATGG - Intronic
1041245894 8:55888235-55888257 GCCCCTTCTTCCAGGGTGTGTGG - Intronic
1042541410 8:69910917-69910939 CCCATTTCTTCTAGATTTTCTGG - Intergenic
1044962248 8:97542698-97542720 CCCACCCCTTCCAAGTTGGCAGG + Intergenic
1045217752 8:100165525-100165547 CCCACTTCCTCCACGGTGCCGGG + Intronic
1046743457 8:117852425-117852447 CACACTACTTCCAGGTTTTGGGG + Intronic
1046891509 8:119426899-119426921 CCAACTTCTCCCAGTTTGCCTGG - Intergenic
1047388428 8:124431234-124431256 CCCATTTCTTCCAGGTTATCTGG - Intergenic
1048201068 8:132374174-132374196 CCGACTTGCTCCATGTTGTCAGG + Intronic
1048373010 8:133796203-133796225 CCCATTTCTTCTAGATTTTCTGG - Intergenic
1048862845 8:138736726-138736748 CCTCCTTCTTCCAGCTTCTCTGG - Intronic
1050502858 9:6316636-6316658 CCCACTCCTTCTAGCTTGTAGGG - Intergenic
1053076518 9:35138953-35138975 CCCGCCCCTTCCAGGTTGGCAGG + Intergenic
1053387509 9:37706138-37706160 CCCTCTGCTTCTAGGTTGTGTGG + Intronic
1058647610 9:107145260-107145282 TCCACGTATTCCAGGTTGGCTGG - Intergenic
1059510658 9:114842625-114842647 CCCATTTCTTCTAGATTTTCTGG - Intergenic
1061641773 9:131963837-131963859 CCCATTTTCTCCGGGTTGTCAGG - Intronic
1186367239 X:8908383-8908405 CCAAATTCTTCCAGTTTCTCAGG + Intergenic
1191597646 X:62963439-62963461 CCCATTTCTTCCAGATTTTCTGG + Intergenic
1194424977 X:93725449-93725471 CCCAATTCTCCCAGGCTGGCGGG + Intergenic
1195233787 X:102877401-102877423 CCCACTTCTTCCTGTTTCCCGGG + Intergenic
1195261350 X:103134768-103134790 TCCATTTCTTCCAGATTTTCTGG - Intergenic
1199348904 X:146776372-146776394 CCCATGTCTTCTAGGTTTTCTGG + Intergenic
1200047395 X:153410112-153410134 CCCACCTCTTCCAGCTTCTGGGG + Intergenic
1200089290 X:153626849-153626871 CCCACCTCTTCCAGCTTCTGGGG - Intergenic