ID: 1109029474

View in Genome Browser
Species Human (GRCh38)
Location 13:57174693-57174715
Sequence TGTTGCATCCCACTTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 6, 1: 0, 2: 0, 3: 16, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109029474_1109029475 -10 Left 1109029474 13:57174693-57174715 CCTGGAAGAAGTGGGATGCAACA 0: 6
1: 0
2: 0
3: 16
4: 187
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1109029474_1109029476 -6 Left 1109029474 13:57174693-57174715 CCTGGAAGAAGTGGGATGCAACA 0: 6
1: 0
2: 0
3: 16
4: 187
Right 1109029476 13:57174710-57174732 GCAACAAGTGTCAGTAAGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109029474 Original CRISPR TGTTGCATCCCACTTCTTCC AGG (reversed) Intergenic
902362230 1:15948182-15948204 TGTTGCATCCCACAGCCTGCAGG + Intronic
904773185 1:32892485-32892507 TGCTGCTTCCCACTTCTCCTTGG - Intronic
904896469 1:33821825-33821847 TGTTCGATGCCACCTCTTCCAGG - Intronic
905242694 1:36591114-36591136 TGTTGAGTCCCAGCTCTTCCTGG + Intergenic
905953468 1:41972638-41972660 TGTTACATGCCACCTCTTCAAGG - Intronic
907273928 1:53306579-53306601 GGTTGGATCCCACTGCTCCCTGG + Intronic
908385022 1:63633146-63633168 AGTTGGATGCCACTTCTTCCAGG - Intronic
909086338 1:71173576-71173598 TTTTGCTTGGCACTTCTTCCTGG - Intergenic
909429145 1:75566114-75566136 TGTGGCATTCCATTTCCTCCTGG - Intronic
911131911 1:94397333-94397355 TGTGGGATCCCACTTGATCCTGG - Intergenic
911764011 1:101652687-101652709 TGTGTCATCCCACTTCCTCCTGG + Intergenic
911889450 1:103348628-103348650 AGTGGCCTCCCAGTTCTTCCTGG - Intergenic
912605904 1:110988094-110988116 TATATCATCCCACTCCTTCCTGG - Intergenic
913281826 1:117192223-117192245 TATATCATCCCATTTCTTCCTGG - Intronic
914731572 1:150375694-150375716 TTTTTCCTCCCACTTTTTCCAGG + Intronic
914839004 1:151232311-151232333 TGTTGCCTTCCGCTACTTCCGGG + Exonic
916826761 1:168449391-168449413 TCTTGCATCACGCTTCTACCTGG + Intergenic
917841040 1:178978110-178978132 TATGGCATCCCACTCTTTCCTGG - Intergenic
918790976 1:188828326-188828348 TGTTACATTCCATTACTTCCTGG + Intergenic
920685375 1:208105165-208105187 TGCTGCATCCCACCCCATCCTGG - Intronic
922190737 1:223316456-223316478 TGTTCCAACCCCCTTCCTCCAGG - Intronic
1063131905 10:3185544-3185566 TTTTGTGACCCACTTCTTCCTGG + Intergenic
1064006439 10:11702883-11702905 TGTTCCATCACACTTATCCCAGG + Intergenic
1065366688 10:24944111-24944133 GGTCACACCCCACTTCTTCCTGG + Intronic
1067475587 10:46563842-46563864 TTTTGCAGCCCACTTTTTGCAGG - Intergenic
1067619148 10:47777933-47777955 TTTTGCAGCCCACTTTTTGCAGG + Intergenic
1068786860 10:60986214-60986236 TGATGCTTCCCTCATCTTCCAGG + Intronic
1074178948 10:111040148-111040170 TGTTTTATTCCACTTCCTCCTGG - Intergenic
1074453403 10:113577480-113577502 TCTTGAAACTCACTTCTTCCAGG + Intronic
1075097953 10:119485142-119485164 TGTTGCCTCCCACTGCTCCTGGG + Intergenic
1077119403 11:899861-899883 TGGTGCAGCCCCCATCTTCCAGG - Intronic
1080766685 11:35303808-35303830 TCTTGCCTCCCACTTCTTTAAGG - Intronic
1080896561 11:36453170-36453192 TATCCCATCCCACTTCTACCAGG - Intronic
1081303179 11:41478370-41478392 TCTAGCATCCCACTTATTCCTGG - Intergenic
1081964469 11:47161281-47161303 TGTAACATCCCACATCTGCCAGG + Intronic
1084978890 11:72818036-72818058 TGTTGGAGCCCACTTCATCCTGG - Intronic
1088373409 11:109115636-109115658 TGTTGCTTGCCACTTCTGCCAGG - Intergenic
1089099425 11:115949309-115949331 CCTTGCATGCCTCTTCTTCCAGG - Intergenic
1089113267 11:116073612-116073634 GCTTACATGCCACTTCTTCCAGG + Intergenic
1089890967 11:121880287-121880309 TGTTGCTTCTCACTTCCTTCTGG + Intergenic
1093273636 12:17097066-17097088 TTTTGCAGCCCACTTCTTGCTGG + Intergenic
1093355968 12:18167641-18167663 TGATCCATCCCACTTCAGCCTGG + Intronic
1094228054 12:28068666-28068688 TGTATCATCCCACTTCCTCTTGG - Intergenic
1094787361 12:33864010-33864032 TATATCATCCCACTTCCTCCTGG + Intergenic
1096219942 12:49822953-49822975 TGTGGCATCCAACCTCTTCCAGG + Intronic
1097249407 12:57624367-57624389 TCATGCTTTCCACTTCTTCCTGG + Intronic
1101747721 12:107556469-107556491 CTTTGCATCCCAGTTCTGCCTGG - Intronic
1101930039 12:109006461-109006483 TGTGGCATGCCCCTTCTTCTTGG - Intronic
1104372103 12:128232497-128232519 GGTTGACTCCCACTACTTCCAGG - Intergenic
1104889285 12:132132609-132132631 TGTTGCCTCCCACCCCTGCCCGG + Intergenic
1108722846 13:53149456-53149478 TGTAAAATGCCACTTCTTCCAGG - Intergenic
1108779803 13:53815801-53815823 TGATGCATCCAACTACTTCAAGG - Intergenic
1109024800 13:57143242-57143264 TGTTGCATCCCACTTCTTCCAGG - Exonic
1109025787 13:57149812-57149834 TGTTGCATCCCACTTCTTCCAGG - Exonic
1109026777 13:57156385-57156407 TGTTGCATCCCACTTCTTCCAGG - Exonic
1109027769 13:57162956-57162978 TGTTGCATCCCACTTCTTCCAGG - Exonic
1109028755 13:57169521-57169543 TGTTGCATCCCACTTCTTCCAGG - Exonic
1109029474 13:57174693-57174715 TGTTGCATCCCACTTCTTCCAGG - Intergenic
1109262227 13:60158388-60158410 TGTTGCAGCCAAATCCTTCCAGG - Intronic
1113734100 13:112664847-112664869 TGTTGCATCCCACATCTGGTGGG + Intronic
1114778252 14:25511207-25511229 TGTGGCTCCCCACTGCTTCCAGG + Intergenic
1114849376 14:26365303-26365325 TGTTACAGCCCATTTCTTCTAGG - Intergenic
1115426372 14:33264801-33264823 TCTTGCCTCCCACTTCATCAGGG + Intronic
1118228165 14:63922433-63922455 TGTGACATTCCACTTATTCCCGG + Intronic
1120033078 14:79664710-79664732 TCTTGCCTCTCACTTCTCCCAGG + Intronic
1122559869 14:102605208-102605230 AGTTACATTCCTCTTCTTCCTGG + Intronic
1122986044 14:105212053-105212075 GGAGGCAGCCCACTTCTTCCTGG - Intronic
1123135836 14:106026827-106026849 TGTTGCTTCCCTGTTCTCCCAGG + Intergenic
1124660975 15:31550677-31550699 TGTATCATCCCACAGCTTCCGGG - Intronic
1125489670 15:40137179-40137201 TGTCCCCTCCCACTTCTTCCAGG - Intergenic
1129269179 15:74410515-74410537 CCTTGCCTGCCACTTCTTCCAGG - Exonic
1129356893 15:74997293-74997315 TGCTGTATCACACTTCCTCCAGG - Exonic
1130202879 15:81849731-81849753 TGTTGCATCTGATTTTTTCCAGG + Intergenic
1131938758 15:97537323-97537345 TATTTCATCCCACTTGATCCAGG + Intergenic
1133192173 16:4142218-4142240 TGATCCATCCAACTGCTTCCTGG - Intergenic
1134126842 16:11621893-11621915 TGCTGCAGCCCATTTCTTCTGGG + Intronic
1134335358 16:13294393-13294415 TGTATCATTCCTCTTCTTCCTGG + Intergenic
1137558143 16:49485810-49485832 TGCTGATTCTCACTTCTTCCAGG + Intergenic
1141997926 16:87647102-87647124 TGGGGCATCCAACCTCTTCCTGG + Intronic
1143718097 17:8789810-8789832 AGATGCCTCCCACATCTTCCCGG - Intergenic
1146499481 17:33352249-33352271 CACTGCATCCCACTCCTTCCAGG + Intronic
1147385036 17:40075952-40075974 TGTTGCAGGCCCCTTCCTCCTGG - Intronic
1148593619 17:48835144-48835166 TGTTGGAGCCCATTTCTCCCAGG + Intronic
1148844007 17:50518085-50518107 GGTGGCTTCCCACTGCTTCCTGG + Intronic
1148984698 17:51611531-51611553 TAGCGCATCCCACATCTTCCTGG + Intergenic
1151723919 17:75874012-75874034 TGTTCCAGCCCCCTTCTCCCAGG + Intergenic
1152323010 17:79618964-79618986 TGTTGCCTCCATCTCCTTCCTGG - Intergenic
1152520304 17:80852383-80852405 TGTCGCATGCCACTGCTGCCTGG - Intronic
1153934053 18:9905010-9905032 TGTTGCTGCCTACTTCTTCCTGG - Intergenic
1155329615 18:24701601-24701623 TGTTGCTTTTCACTTTTTCCTGG + Intergenic
1161519731 19:4717115-4717137 TGTTTCATCCTACTCCATCCAGG + Intronic
1163175350 19:15560926-15560948 TGTTGCCTCCCACCTACTCCAGG + Intergenic
1164281070 19:23769269-23769291 TGTGACTTCACACTTCTTCCTGG + Intronic
1164871159 19:31644713-31644735 CGTTGCATTCCACTTCCTCAGGG - Intergenic
925076169 2:1018124-1018146 TGTTGACTCCCACTTTTTACTGG + Intronic
928935574 2:36674013-36674035 TGTTGCTTCCTATTTCTTTCTGG - Intergenic
929328043 2:40642337-40642359 TGTTGCTTCCTAGTTCTTCTTGG - Intergenic
929456531 2:42069966-42069988 TTTTGCATCCCATTTATTCTTGG - Intergenic
930173877 2:48281375-48281397 TGTTGCATCACAGATATTCCAGG + Intergenic
930663472 2:54078935-54078957 TTTTGCATCCCACTCCTTGAAGG + Intronic
931638252 2:64359895-64359917 TGTTGCCTCCTTCTTCTCCCTGG + Intergenic
931892263 2:66686417-66686439 TTTTTCTTCCCCCTTCTTCCAGG + Intergenic
933683032 2:85119853-85119875 TGTGGCATACCCCTTCTTCTTGG - Intergenic
935661420 2:105469829-105469851 TGATGCATCCAAAGTCTTCCAGG + Intergenic
936536089 2:113312505-113312527 GTATGCATCCTACTTCTTCCAGG + Intergenic
937665493 2:124482718-124482740 TGTGGAATCCCACTGCTCCCTGG + Intronic
945620417 2:212128805-212128827 TGTTGAATATCATTTCTTCCTGG - Intronic
947105633 2:226664893-226664915 TTTTGCATACTACTTCTTCTAGG - Intergenic
947400093 2:229723348-229723370 TTTTGCTTGGCACTTCTTCCTGG - Intergenic
948453887 2:238095463-238095485 TGTTGCTTCTTTCTTCTTCCTGG + Intronic
948485711 2:238279557-238279579 TGTGGCATTCCACTTCTGCATGG + Intronic
1170990277 20:21295090-21295112 TTTTCCATCCAGCTTCTTCCAGG + Intergenic
1172219581 20:33264297-33264319 TGTTGCACCCAGCTTCTCCCTGG + Intergenic
1179339667 21:40493059-40493081 TGTATCATCCCACCTCCTCCTGG - Intronic
1181785117 22:25221382-25221404 TGCTGCTTCCCATGTCTTCCAGG + Exonic
1182086574 22:27565206-27565228 TGTTGCCTCCTGCCTCTTCCTGG + Intergenic
1182309233 22:29392950-29392972 TGTTGCATCCCCAGTGTTCCTGG - Intronic
1182332716 22:29562194-29562216 TTATGCATGCCACTGCTTCCAGG - Intronic
1183423658 22:37726102-37726124 TGAGCCATCCCTCTTCTTCCAGG + Exonic
1183702723 22:39458838-39458860 GTTTTCATCTCACTTCTTCCAGG - Intronic
1184089520 22:42284895-42284917 TGTTGTGTCCCAATGCTTCCTGG - Intronic
1184969263 22:48003477-48003499 TGTTGCCTCCCCCTTGTTGCTGG - Intergenic
1185394439 22:50579479-50579501 TCTGGCATCCCATTTCTTCTGGG - Exonic
950267266 3:11583645-11583667 GATTGCAGCCCACTCCTTCCCGG - Intronic
952490929 3:33871844-33871866 TTGTGCACCCCTCTTCTTCCAGG - Intergenic
957243666 3:77691154-77691176 TGTTGCATCTTACTTCTTCAGGG - Intergenic
957289884 3:78266504-78266526 TATGTCATCCCATTTCTTCCTGG + Intergenic
959132253 3:102371219-102371241 TACTGCCTCCCACTTCTTCAGGG + Intronic
960245155 3:115392352-115392374 TGTCCCATCACACTTCTGCCTGG + Intergenic
960487001 3:118265799-118265821 TACATCATCCCACTTCTTCCTGG + Intergenic
960737732 3:120799015-120799037 TGTGGCAACCGGCTTCTTCCTGG - Intergenic
961600901 3:128061229-128061251 TGTTGCTTCTCACTGCATCCTGG - Intronic
961632526 3:128311841-128311863 TCTTACGTCCCACCTCTTCCTGG + Intronic
962369162 3:134806457-134806479 TGTTGCAACCCCATCCTTCCAGG + Intronic
964171628 3:153777270-153777292 TGTGGAATCCAACTTCTTCATGG + Intergenic
966489601 3:180513265-180513287 TGTTGCACTCCATTTCTTCATGG + Intergenic
968811493 4:2801465-2801487 TGTTGCCTCCCTCTTGCTCCTGG + Intronic
969265889 4:6063879-6063901 TGCTGCACCCCACAGCTTCCTGG - Intronic
970148509 4:13064735-13064757 TGTGTCATCCCACTCCTTCCTGG + Intergenic
970444795 4:16114708-16114730 TCCTGCTTCCAACTTCTTCCTGG - Intergenic
970794396 4:19893626-19893648 TGTTGCATCCCATCCCTCCCAGG - Intergenic
974630916 4:64487611-64487633 AGTTGCATCTTACTGCTTCCAGG - Intergenic
975257569 4:72255743-72255765 TGCTGCAGCAAACTTCTTCCTGG - Intergenic
975854247 4:78606284-78606306 TGCTGCTTCCCTCTTCATCCTGG - Intronic
977149414 4:93491002-93491024 TGTTGCTTCCCACATTTTCCTGG + Intronic
977355777 4:95943950-95943972 AGTTGCCTCCCACTTCTTACTGG + Intergenic
977389217 4:96386211-96386233 GGTTGCATACCAATTCTTCTTGG + Intergenic
979957287 4:126969589-126969611 TGTTGCATCCATTTTCCTCCAGG + Intergenic
982371591 4:154639247-154639269 AGATTCTTCCCACTTCTTCCAGG - Intronic
984530461 4:180909612-180909634 TGTGGCATGCCTCCTCTTCCAGG + Intergenic
984985998 4:185329941-185329963 TGCTGCTGCCCACTGCTTCCTGG + Intronic
990060463 5:51640422-51640444 TCTTGCATCCCACTTAATCTTGG - Intergenic
990596141 5:57314379-57314401 TTTTCCATCCCCCTTCTTCTTGG + Intergenic
993991334 5:94661501-94661523 TCTTGAAGCCCCCTTCTTCCAGG + Intronic
994173642 5:96686117-96686139 TATTTCTTCCCACTTCTCCCAGG + Intronic
995681308 5:114723146-114723168 TGCTGCTGCCCACTGCTTCCTGG - Intergenic
999252772 5:150192459-150192481 AGTTGCTTCATACTTCTTCCTGG - Intronic
999579192 5:153015643-153015665 TGTATCATCCCACTTCCTTCTGG - Intergenic
1001459243 5:171894934-171894956 TGTTGCAGCCCACTTTTTTTTGG - Intronic
1001672735 5:173487589-173487611 TGTAGCCTCCCACTCCCTCCAGG - Intergenic
1002135556 5:177105555-177105577 TGCTGCACCCCAGTTCTACCAGG - Intergenic
1006914756 6:37587095-37587117 TTTTGCATCCCACTCTCTCCAGG - Intergenic
1007393844 6:41566014-41566036 GGCTGCATTCCACTTCATCCTGG + Intronic
1008732293 6:54496864-54496886 TATGTCATCCCACCTCTTCCTGG - Intergenic
1014130888 6:117830973-117830995 TATGTCATCCCACTTTTTCCTGG - Intergenic
1017035394 6:150262629-150262651 TGTGACCTCCCTCTTCTTCCTGG + Intergenic
1017775345 6:157676157-157676179 TGCAGCATCCCCCTGCTTCCTGG - Exonic
1020563000 7:9754980-9755002 GTTTGCATCCCACTTCATCATGG + Intergenic
1021787162 7:24163909-24163931 CCTTGCATCACACTTCTGCCTGG - Intergenic
1022531185 7:31067924-31067946 TGCTACATCCCAGTTCTTCTGGG + Intronic
1023172253 7:37401118-37401140 TCTGGCTTCCCACTTCTTCCTGG - Intronic
1023634439 7:42195527-42195549 GCTTGCATACCTCTTCTTCCAGG + Intronic
1023775796 7:43605649-43605671 TGCTGCATTCCACTTCTGCTTGG + Intronic
1024252496 7:47517094-47517116 TGTTGTATCCCAATTCAGCCTGG + Intronic
1024425404 7:49219896-49219918 TGTTGCAGCCCACTTCCTGATGG - Intergenic
1027766557 7:82350935-82350957 TGTTCTATCTCACTTTTTCCTGG + Intronic
1027934772 7:84588645-84588667 AGTTGCATCCAACTTTCTCCAGG - Intergenic
1028618003 7:92791671-92791693 TGTTGAATGCCTCTTCTTCAGGG - Intronic
1028922192 7:96321527-96321549 TGTTGACTCCGGCTTCTTCCAGG - Intronic
1031001625 7:116422021-116422043 TGATGCATCCCATTTTTTCATGG - Intronic
1032480347 7:132241020-132241042 TCGTGCCTCCCACTTCCTCCTGG - Intronic
1033610559 7:142960294-142960316 TCTAACATCCCACTTGTTCCAGG + Intronic
1034285371 7:149880267-149880289 TGTTGCTTCCCACTCCTGCCAGG - Exonic
1036569137 8:9964473-9964495 TGGTGCATCCCACTCCTTTGTGG + Intergenic
1037488276 8:19371381-19371403 TGTATCATCTCACTTCTTTCTGG + Intronic
1037648365 8:20814508-20814530 TGTTGCATCCCAGTGCCTGCAGG + Intergenic
1039358963 8:36854034-36854056 TATTTCATCCTACTTCTTTCTGG + Intronic
1039366004 8:36928465-36928487 TGTTACATCCCACTACCACCTGG - Intronic
1041299976 8:56401264-56401286 TTTTGCCTTCCCCTTCTTCCTGG - Intergenic
1042656591 8:71104990-71105012 TGTTACATCCCAGTGCTGCCAGG + Intergenic
1045963182 8:107992975-107992997 TGTTGCATTCTACTTCCTCTGGG - Intronic
1050024093 9:1315663-1315685 TGTAGCTTCCCTCTTATTCCAGG - Intergenic
1051681869 9:19615669-19615691 TGTAGCCTCCCACATCTTTCAGG + Intronic
1052689617 9:31801116-31801138 TATTTCATCCCACTCCCTCCTGG - Intergenic
1055445503 9:76378127-76378149 TGTTACATCCCAATTCCTCCAGG + Intergenic
1057451594 9:95167130-95167152 TGTATCATCCCACTCCTTTCTGG + Intronic
1057915690 9:99053473-99053495 TGTTCCCTCCCCCTCCTTCCAGG - Intronic
1057932745 9:99210308-99210330 TGTATCATCCCATTTTTTCCTGG + Intergenic
1060172423 9:121472946-121472968 TCTTGAAGCCCACTTCTTTCTGG + Intergenic
1060726028 9:126006508-126006530 TGTTGCAGCCTCCTTCCTCCTGG + Intergenic
1061608958 9:131733437-131733459 TTTTGAGTCCCACTCCTTCCTGG + Intronic
1061762303 9:132859147-132859169 TGTTGCTTCCCAGTCCTGCCTGG - Intronic
1061891815 9:133625653-133625675 TTTTGCAGCAGACTTCTTCCTGG + Intergenic
1062012333 9:134273848-134273870 TTTTGGATGCAACTTCTTCCAGG + Intergenic
1190842682 X:54160483-54160505 TGTTGTACCACGCTTCTTCCTGG + Intronic
1192011227 X:67276019-67276041 TGTGGCAGCCCACTTCTTAGTGG - Intergenic
1192332838 X:70191846-70191868 TGTATCATCCCACTCCCTCCTGG - Intronic
1192855619 X:75007690-75007712 TGTTGCATTCCAGATCTTACTGG + Intergenic
1195032463 X:100939559-100939581 TGCTGCTTCACTCTTCTTCCAGG - Intergenic