ID: 1109029475

View in Genome Browser
Species Human (GRCh38)
Location 13:57174706-57174728
Sequence GGATGCAACAAGTGTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109029470_1109029475 3 Left 1109029470 13:57174680-57174702 CCAAACCAGACAACCTGGAAGAA 0: 1
1: 5
2: 0
3: 18
4: 195
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1109029472_1109029475 -2 Left 1109029472 13:57174685-57174707 CCAGACAACCTGGAAGAAGTGGG 0: 6
1: 0
2: 1
3: 14
4: 190
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1109029474_1109029475 -10 Left 1109029474 13:57174693-57174715 CCTGGAAGAAGTGGGATGCAACA 0: 6
1: 0
2: 0
3: 16
4: 187
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1109029468_1109029475 14 Left 1109029468 13:57174669-57174691 CCAGGAAAAAGCCAAACCAGACA 0: 1
1: 0
2: 2
3: 33
4: 283
Right 1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109029475 Original CRISPR GGATGCAACAAGTGTCAGTA AGG Intergenic
906818500 1:48903899-48903921 GGATGGAGCAAGTGACAGGAAGG + Intronic
908771502 1:67600994-67601016 GGAAATAACAAGTGTCAGCAAGG - Intergenic
909345231 1:74577348-74577370 GGTTGACACAAGTGGCAGTAAGG - Intronic
910252696 1:85214620-85214642 GGATGCAACATGTGTGAGGAAGG + Intergenic
911732364 1:101304412-101304434 GAATGGAGCAAGTGCCAGTAGGG + Intergenic
913346796 1:117817800-117817822 TGACACAACAAGTGACAGTAGGG - Intergenic
914450032 1:147783119-147783141 GGATGCAACTATTTTCAGTTTGG - Intergenic
916204351 1:162300822-162300844 GGAAGCAACAGGTCTCAGGAGGG - Intronic
1066506513 10:36050264-36050286 GGATCCAACAATTCTCAGGAGGG - Intergenic
1072697857 10:97617374-97617396 GGATGCTACAAGAGTAAGAAGGG - Intronic
1075861834 10:125683765-125683787 GGATGCCACAAGTCCCAGCAAGG + Intergenic
1078050740 11:7963027-7963049 GGTTCCAACAACTGTCAGGAGGG - Intronic
1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG + Intergenic
1089884642 11:121808061-121808083 GGATTCAACAAGTGAAAGTAAGG - Intergenic
1092984252 12:13829981-13830003 GGATGGAACAAGAGTCTGTGTGG + Intronic
1099275040 12:80563909-80563931 GTATTCAACATTTGTCAGTATGG + Intronic
1100413530 12:94347393-94347415 GAAAATAACAAGTGTCAGTAGGG + Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1112213067 13:97400758-97400780 TGATGGAACAGATGTCAGTATGG + Intergenic
1112344719 13:98579508-98579530 GGATGAAACAATGGTCAGTGTGG - Intergenic
1117361278 14:54976680-54976702 GGAAGCAACACTTCTCAGTATGG - Intronic
1118966340 14:70589364-70589386 GAATGCAACTAGTAACAGTATGG - Intronic
1137492552 16:48945031-48945053 GGAAGGAAGAAGTGTCAGTAGGG - Intergenic
1143713287 17:8748851-8748873 GGATGCAGCAAGGGACAGGAAGG + Intergenic
1146834476 17:36099170-36099192 GGTTGCAAGAAGTGACAGCAAGG - Intergenic
1146849087 17:36206356-36206378 GGTTGCAAGAAGTGACAGCAAGG - Intronic
1149523764 17:57338542-57338564 GGATGCAACAAGTCTGCGTGGGG - Intronic
1154232650 18:12571560-12571582 GGTTGCAATCAGTGTCAGCATGG - Intronic
1160016318 18:75143455-75143477 GGATCCAACAAGTGTCTGAAGGG + Intergenic
1160036004 18:75302366-75302388 GGATGCTACAAGTGTGATCAAGG - Intergenic
1165354331 19:35294210-35294232 GCATGCAACAAGAGTCACTCAGG - Intronic
926888317 2:17617715-17617737 GGAGGCAGCAAGTGGAAGTAAGG + Intronic
929989289 2:46771763-46771785 GGATGCAGCAAGGGCCAGGACGG - Intergenic
936895466 2:117422719-117422741 GGATCCAAAAAGTGGCACTATGG + Intergenic
940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG + Intergenic
1172305909 20:33880574-33880596 GGATGCACCAAGGGGCAGGAAGG + Intergenic
1173000564 20:39102472-39102494 GGGTGCATCAAGTCTCAGTAGGG - Intergenic
1174418442 20:50383493-50383515 GGATAAAACAAGTCTCAGGATGG - Intergenic
1179261672 21:39763505-39763527 GGAGGCCACACGTGTCACTACGG - Intronic
1181969658 22:26680619-26680641 GAATGAAACAAGAGTCAGTTGGG + Intergenic
1183278539 22:36918380-36918402 GAATGCAACAAGGGTCAGATTGG - Intronic
950615424 3:14154131-14154153 GAAAGTAACAAGTGTCAGTGAGG + Intronic
951797744 3:26560021-26560043 AGATGAGAAAAGTGTCAGTACGG + Intergenic
955635066 3:61019399-61019421 GCATGCAACAGGTGGGAGTAAGG + Intronic
958504438 3:94956231-94956253 GGAAGCAGCAAGTGTCAGCGAGG - Intergenic
959502415 3:107121553-107121575 GGATGCAACAAATCTCATTTGGG + Intergenic
967612282 3:191521560-191521582 GGATTCTACACATGTCAGTAAGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970010851 4:11457489-11457511 AGATGCAAAAAGTGTCTGAAAGG + Intergenic
971960796 4:33484641-33484663 GGATGAAATAAGTAACAGTATGG + Intergenic
972716880 4:41655397-41655419 TCATGCAACAAGTGGGAGTAAGG + Intronic
975445567 4:74460558-74460580 GGATACAACAAGTAGCAATAGGG - Intergenic
978143828 4:105348567-105348589 GGATGCATCAAGTCTCACTGAGG - Intergenic
982144821 4:152374763-152374785 GGATGAAACCAGTGCCAGAAGGG + Intronic
985933671 5:3078653-3078675 GGATCTACTAAGTGTCAGTAGGG + Intergenic
986150544 5:5126063-5126085 GGCTGCAACATGTGTCACCAGGG + Intergenic
987674204 5:21052732-21052754 GAATGAAAGAAGTGTCAGTGAGG + Intergenic
993472703 5:88325324-88325346 GCACCCAACAAGTTTCAGTATGG + Intergenic
996438652 5:123464001-123464023 AGATATAACAAGTGTCAGTGAGG - Intergenic
1008628217 6:53338283-53338305 GGATGTGACAAGTGACAGTAAGG - Intronic
1013440715 6:110164469-110164491 TCATGCATCATGTGTCAGTAGGG + Intronic
1013641813 6:112090957-112090979 GGATACAATAAGTTTCAGTTAGG - Intronic
1016733782 6:147453957-147453979 GGCTGCAACAATTGGCAGCAAGG - Intergenic
1021254945 7:18380542-18380564 GGATGCAGCAATTGACTGTATGG + Intronic
1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG + Intergenic
1029303436 7:99601821-99601843 GGCTGCAGCAAGTGTCTGCATGG + Intronic
1034694213 7:153039661-153039683 GGAAGCCACAAATGTCACTATGG + Intergenic
1036595160 8:10205314-10205336 GGATGCTACAGGTGTCTGGAGGG + Intronic
1037564350 8:20104979-20105001 GGAAGCAACATGTATCAGTCAGG - Intergenic
1038269583 8:26064370-26064392 GGGTGCCCCAGGTGTCAGTATGG - Intergenic
1042028390 8:64447869-64447891 GGACGCACCATGTGACAGTAAGG - Intergenic
1043867489 8:85392625-85392647 GGAGGTAACAAGAGTCAGTCTGG + Intronic
1043925104 8:86027878-86027900 GGATGAGACAAGTAGCAGTACGG - Intronic
1045682204 8:104674376-104674398 GGAAGACACAAGTGCCAGTAAGG - Intronic
1047234325 8:123026097-123026119 AAACCCAACAAGTGTCAGTAAGG + Intronic
1048592209 8:135831281-135831303 GGATGCATCAATTTTCAGTAAGG - Intergenic
1049048139 8:140169280-140169302 GGAGGTAACAAGTGTTGGTAAGG + Intronic
1050379526 9:5012248-5012270 GGATGGAAGAAGAGTAAGTATGG + Intronic
1051923160 9:22291455-22291477 TGAAGCAAAAAGTGTAAGTAAGG - Intergenic
1059473571 9:114525678-114525700 GAATGTAATAAGAGTCAGTAGGG - Intergenic
1190439906 X:50467151-50467173 GGTGGCAGCAAGTGTAAGTAAGG - Intronic