ID: 1109031362

View in Genome Browser
Species Human (GRCh38)
Location 13:57193876-57193898
Sequence TCCTATCTTTAGAAGGTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109031362_1109031364 22 Left 1109031362 13:57193876-57193898 CCAGCGACCTTCTAAAGATAGGA No data
Right 1109031364 13:57193921-57193943 TTAAAACTTCAGAGAGAACATGG No data
1109031362_1109031365 28 Left 1109031362 13:57193876-57193898 CCAGCGACCTTCTAAAGATAGGA No data
Right 1109031365 13:57193927-57193949 CTTCAGAGAGAACATGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109031362 Original CRISPR TCCTATCTTTAGAAGGTCGC TGG (reversed) Intergenic
No off target data available for this crispr