ID: 1109032835

View in Genome Browser
Species Human (GRCh38)
Location 13:57215878-57215900
Sequence CTGGCTATGCAGAGCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109032832_1109032835 26 Left 1109032832 13:57215829-57215851 CCAATAGTCTTATTTTTGTTTGT No data
Right 1109032835 13:57215878-57215900 CTGGCTATGCAGAGCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109032835 Original CRISPR CTGGCTATGCAGAGCTACAA AGG Intergenic
No off target data available for this crispr