ID: 1109035951

View in Genome Browser
Species Human (GRCh38)
Location 13:57260476-57260498
Sequence CAGTTGCTATGGAGATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109035951_1109035954 26 Left 1109035951 13:57260476-57260498 CCATCTGATCTCCATAGCAACTG No data
Right 1109035954 13:57260525-57260547 GTTGATCCATTTGCAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109035951 Original CRISPR CAGTTGCTATGGAGATCAGA TGG (reversed) Intergenic
No off target data available for this crispr