ID: 1109035954

View in Genome Browser
Species Human (GRCh38)
Location 13:57260525-57260547
Sequence GTTGATCCATTTGCAACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109035953_1109035954 15 Left 1109035953 13:57260487-57260509 CCATAGCAACTGAGGAACACATT No data
Right 1109035954 13:57260525-57260547 GTTGATCCATTTGCAACATTTGG No data
1109035951_1109035954 26 Left 1109035951 13:57260476-57260498 CCATCTGATCTCCATAGCAACTG No data
Right 1109035954 13:57260525-57260547 GTTGATCCATTTGCAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109035954 Original CRISPR GTTGATCCATTTGCAACATT TGG Intergenic
No off target data available for this crispr