ID: 1109062067

View in Genome Browser
Species Human (GRCh38)
Location 13:57632450-57632472
Sequence TCGCGCGCGCACGCTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109062066_1109062067 -3 Left 1109062066 13:57632430-57632452 CCATAGACTTGTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51
1109062062_1109062067 28 Left 1109062062 13:57632399-57632421 CCGCAGCTCGGGTGCAGAGGGAA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51
1109062065_1109062067 -2 Left 1109062065 13:57632429-57632451 CCCATAGACTTGTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109062067 Original CRISPR TCGCGCGCGCACGCTGCGCC AGG Exonic