ID: 1109062067

View in Genome Browser
Species Human (GRCh38)
Location 13:57632450-57632472
Sequence TCGCGCGCGCACGCTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109062062_1109062067 28 Left 1109062062 13:57632399-57632421 CCGCAGCTCGGGTGCAGAGGGAA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51
1109062065_1109062067 -2 Left 1109062065 13:57632429-57632451 CCCATAGACTTGTGGCTCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51
1109062066_1109062067 -3 Left 1109062066 13:57632430-57632452 CCATAGACTTGTGGCTCGCGTCG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109062067 Original CRISPR TCGCGCGCGCACGCTGCGCC AGG Exonic
900109676 1:1000237-1000259 TCGCCCGCGGAGGCCGCGCCCGG - Intergenic
900180699 1:1309777-1309799 CCCCGTGCGAACGCTGCGCCGGG + Exonic
906719746 1:47996717-47996739 TCGCGCCCGCCCGCAGCCCCCGG - Exonic
907351797 1:53838121-53838143 TCGCGCGTGCGCGCTGGGCGGGG - Intronic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
1065099107 10:22316329-22316351 CCGCGCGCGCACGCGGCTCGGGG - Exonic
1076919949 10:133446209-133446231 TCGCGCCCGGAAGCTGCCCCGGG - Intergenic
1077037974 11:504395-504417 CCGCCCGCGCCCGCTCCGCCCGG + Intronic
1085396312 11:76208802-76208824 TCGCGCGGGGAGGCAGCGCCTGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096127678 12:49131489-49131511 CCGCGCGCCCACTCCGCGCCCGG + Intergenic
1100329514 12:93571006-93571028 TCGCGCGCACTCGCTGCTCCTGG + Intronic
1104602449 12:130162667-130162689 TCGCGCCGGGCCGCTGCGCCGGG + Exonic
1108314040 13:49220789-49220811 GAGCGCGCGGACGCGGCGCCGGG - Exonic
1108350337 13:49585609-49585631 TCCCGGGCGCGCGCTGCACCGGG - Intergenic
1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG + Exonic
1118312653 14:64704884-64704906 GCGCTCGCGCACTCTGCGGCAGG - Intronic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1126849881 15:52790404-52790426 TCGCGCATGCGCGCTGCGCCTGG - Intronic
1127674564 15:61227797-61227819 TCGCGCGAGCACGCTTCCTCCGG + Intronic
1129710749 15:77819275-77819297 CCGCGCGCGGACGGCGCGCCCGG - Intronic
1130335198 15:82952389-82952411 GCGAGCGCACACTCTGCGCCCGG - Intronic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1139754656 16:69132624-69132646 GCGCGCGCGCACGTGGGGCCGGG + Exonic
1147015669 17:37489811-37489833 GCGCGCACGCTCCCTGCGCCTGG - Exonic
1147896590 17:43755500-43755522 GCGCGCGCGCAAGGTGCGCCTGG - Exonic
1148553454 17:48564254-48564276 CCCCGCGCGCACCCAGCGCCCGG - Intronic
1151570869 17:74924671-74924693 TGGGGCCCGCACGCGGCGCCGGG - Exonic
1152809546 17:82375080-82375102 GGGGGCGCGCGCGCTGCGCCTGG + Exonic
1161626817 19:5331867-5331889 TCGAGCGCGGACGCTGGCCCAGG + Intronic
1162363058 19:10231091-10231113 TGGGGCGCGCACGCGCCGCCTGG - Intronic
1162954508 19:14090796-14090818 CCGCACGCGCGCCCTGCGCCCGG + Intronic
1165129339 19:33622275-33622297 TCGGGTGCGTCCGCTGCGCCAGG + Intronic
1165672592 19:37692224-37692246 TCGCTGGCACAAGCTGCGCCCGG - Exonic
925068869 2:950894-950916 GCGGGCGCGGACGCGGCGCCTGG + Exonic
925398966 2:3558294-3558316 GCTCGCGCCCACGCTGGGCCGGG - Exonic
925959723 2:9003649-9003671 TCGCCCGCTCGCGCTGTGCCGGG + Exonic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
934966728 2:98730718-98730740 TCGCGCGCCCTCTCTGCGGCCGG - Intronic
935692834 2:105745475-105745497 CCGGGTGCGCAGGCTGCGCCTGG + Intronic
942449447 2:176099978-176100000 TGGCGCCCGCAGGCTGCGCGGGG - Exonic
1169758893 20:9069352-9069374 TCCCGCGCGCACAGGGCGCCTGG - Intronic
1176062353 20:63177976-63177998 TCTCGCGGGCCCGCTGCGCGCGG + Intergenic
1185238736 22:49729286-49729308 CCGAGCCCGCACGCTGCTCCCGG + Intergenic
963607237 3:147421612-147421634 ACGCGCGCGCACGCTGTCGCGGG - Intronic
982000299 4:151015729-151015751 GCGCACGCGCACGCCGCGCCCGG - Intergenic
982291695 4:153788826-153788848 TCGCGCGCCCACGATGCTGCAGG - Exonic
1002091751 5:176810373-176810395 TGGCCCGCGCGCGCTGCGCGGGG + Intergenic
1007473386 6:42104771-42104793 CCGCGGGCGCGCGCTACGCCGGG - Exonic
1024085503 7:45888870-45888892 TGGCGACTGCACGCTGCGCCCGG + Exonic
1031689095 7:124765898-124765920 TCGCGGGCGCGCGCAGCGGCTGG - Intergenic
1034425143 7:151010152-151010174 GCCCCCGTGCACGCTGCGCCAGG + Exonic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1043453715 8:80393417-80393439 CCACAGGCGCACGCTGCGCCTGG + Intergenic
1048981218 8:139704063-139704085 GCGCGCACGCACGTAGCGCCCGG - Intergenic
1185469385 X:373627-373649 CCGCGAGCGCTCGCTGCGCCAGG - Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic