ID: 1109062284

View in Genome Browser
Species Human (GRCh38)
Location 13:57633645-57633667
Sequence ACCAGGGCGATGACGGTGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109062284_1109062290 -7 Left 1109062284 13:57633645-57633667 CCCGGCACCGTCATCGCCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1109062290 13:57633661-57633683 CCCTGGTGCGGGTCACTGACCGG 0: 1
1: 0
2: 0
3: 18
4: 156
1109062284_1109062297 27 Left 1109062284 13:57633645-57633667 CCCGGCACCGTCATCGCCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1109062297 13:57633695-57633717 GAACGGACAGCTGCAGTGTCGGG 0: 1
1: 0
2: 1
3: 5
4: 113
1109062284_1109062296 26 Left 1109062284 13:57633645-57633667 CCCGGCACCGTCATCGCCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1109062296 13:57633694-57633716 AGAACGGACAGCTGCAGTGTCGG 0: 1
1: 0
2: 0
3: 12
4: 112
1109062284_1109062292 -6 Left 1109062284 13:57633645-57633667 CCCGGCACCGTCATCGCCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1109062292 13:57633662-57633684 CCTGGTGCGGGTCACTGACCGGG 0: 1
1: 0
2: 2
3: 7
4: 152
1109062284_1109062294 10 Left 1109062284 13:57633645-57633667 CCCGGCACCGTCATCGCCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1109062294 13:57633678-57633700 GACCGGGACTCTGGCAAGAACGG 0: 1
1: 0
2: 0
3: 8
4: 147
1109062284_1109062293 1 Left 1109062284 13:57633645-57633667 CCCGGCACCGTCATCGCCCTGGT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1109062293 13:57633669-57633691 CGGGTCACTGACCGGGACTCTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109062284 Original CRISPR ACCAGGGCGATGACGGTGCC GGG (reversed) Exonic
900132531 1:1093454-1093476 ACCACAGCCAGGACGGTGCCCGG + Intronic
900925958 1:5706122-5706144 ACCAGAGCTATGACAGGGCCTGG + Intergenic
901127365 1:6939015-6939037 CCCAGGGCGAGGACTGTGCCTGG - Intronic
901411012 1:9084180-9084202 ACCAGTGCCATGACAGTTCCTGG + Intronic
902509059 1:16955765-16955787 TCCAGGGTGATGACGGTGGGTGG - Intronic
904475573 1:30762564-30762586 ACCAGGGCCAGGAGGGAGCCGGG - Intergenic
904872028 1:33625015-33625037 ACCCGGGCGTTGAGGGTGCGGGG - Intronic
904875606 1:33652332-33652354 ACCAGGGCGATGACGTAGTCTGG + Exonic
913957779 1:143320166-143320188 GCCAGGGCCATGACAGAGCCAGG + Intergenic
914052089 1:144145530-144145552 GCCAGGGCCATGACAGAGCCAGG + Intergenic
914127108 1:144821011-144821033 GCCAGGGCCATGACAGAGCCAGG - Intergenic
914827504 1:151146317-151146339 ACCAGGGAGGTGTCGGCGCCCGG - Intronic
915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG + Intergenic
916682201 1:167114841-167114863 ACCAGGGTGAAGACACTGCCTGG - Intronic
920166451 1:204039609-204039631 ACTATGGTGATGACGGTACCAGG - Intergenic
922230226 1:223679412-223679434 ACCAGAGCCTTGATGGTGCCAGG + Intergenic
1066961722 10:42232336-42232358 GCCAGGGCCATGACAGAGCCAGG + Intergenic
1069491691 10:68866730-68866752 ACCAGGGCTGTGAGTGTGCCTGG - Intronic
1070835746 10:79445816-79445838 TGCAGGGCGAGGACAGTGCCAGG - Intergenic
1071955105 10:90749265-90749287 TTCAGGGCGATGACGCTGTCTGG + Exonic
1072043620 10:91633198-91633220 CCCGGGGCGATCACGTTGCCGGG - Intergenic
1076411454 10:130254546-130254568 ACGACGGAGATGACGGTGCTGGG - Intergenic
1076855704 10:133114779-133114801 CCCAGGGCAGTGAAGGTGCCGGG + Intronic
1076858405 10:133128372-133128394 ACCAGGGTGATGATGGCGGCTGG - Exonic
1077168145 11:1152929-1152951 CCCAGGGCGGGGACAGTGCCGGG - Intergenic
1077317446 11:1925730-1925752 ACGAGGGAGCTGACTGTGCCAGG - Intronic
1083436989 11:62649355-62649377 ACCCGGGAAATGATGGTGCCAGG + Exonic
1097263992 12:57735729-57735751 ACCAGGGCTCTGACAGTGGCAGG + Intronic
1106177242 13:27341883-27341905 ACCAGGGAGGTGATAGTGCCTGG + Intergenic
1107425381 13:40287804-40287826 ACCAGGGGAATGACGGTTGCAGG + Intergenic
1109062284 13:57633645-57633667 ACCAGGGCGATGACGGTGCCGGG - Exonic
1109326196 13:60870323-60870345 CCCAGGGAGATGACTGTTCCTGG + Intergenic
1118366799 14:65102889-65102911 TCCAGCGCGCAGACGGTGCCCGG - Intergenic
1202930605 14_KI270725v1_random:29924-29946 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1123421752 15:20141493-20141515 GCCAGGGCCATGACAGAGCCAGG + Intergenic
1123443313 15:20305044-20305066 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1123530978 15:21148033-21148055 GCCAGGGCCATGACAGAGCCAGG + Intergenic
1128361592 15:66965415-66965437 ACTTGGGCTATGACGGTGCAGGG + Intergenic
1131025681 15:89139474-89139496 ACCAGGGCGGTCACTGTGTCCGG + Intronic
1131215213 15:90530281-90530303 GCCAAGGCGATGGCGGGGCCGGG + Intronic
1132939545 16:2500039-2500061 CACAGGGCGATGACGCTGCTGGG - Intronic
1133870825 16:9684344-9684366 ACCAGTGCCATGACAGTTCCAGG + Intergenic
1136722909 16:32338844-32338866 GCCAGGGCCATGACAGAGCCAGG + Intergenic
1136863092 16:33714164-33714186 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1137540828 16:49360454-49360476 ACCAGGGTGAGGACATTGCCTGG + Intergenic
1141558637 16:84852624-84852646 ACCAGGGTGAGGAGGGTGGCTGG + Intronic
1142273903 16:89105678-89105700 GCCCGGGCGCTGACGGTGGCTGG + Intronic
1203003522 16_KI270728v1_random:178920-178942 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1203124577 16_KI270728v1_random:1562317-1562339 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1203135130 16_KI270728v1_random:1715327-1715349 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1143786664 17:9260756-9260778 TCCAGGGTGAGGAGGGTGCCAGG - Intronic
1146313407 17:31788522-31788544 TCCAGGGCGAGGGCTGTGCCAGG - Intergenic
1159608439 18:70499227-70499249 GTCAGGGCGATGGCAGTGCCGGG + Intergenic
1161559216 19:4962287-4962309 ACCCAGGAGATGACGGTGACGGG + Intergenic
1162728919 19:12706051-12706073 AGCAGGGCGAGGGCGGGGCCGGG + Intronic
1167414792 19:49364395-49364417 ACCTGGGAGAAGACGGGGCCTGG + Intronic
1167523919 19:49972248-49972270 ACCAGGGCAGAGACGGGGCCGGG - Intergenic
1168137512 19:54361155-54361177 CCCAGGGGGATCACGGTGCCTGG + Exonic
1202691488 1_KI270712v1_random:97954-97976 GCCAGGGCCATGACAGAGCCAGG + Intergenic
933954902 2:87355996-87356018 GCCAGGGCCATGACAGAGCCAGG - Intergenic
934239091 2:90252210-90252232 GCCAGGGCCATGACAGAGCCAGG - Intergenic
934274092 2:91564488-91564510 GCCAGGGCCATGACAGAGCCAGG + Intergenic
934323167 2:91984597-91984619 TCCAGGGCCAGGACTGTGCCAGG - Intergenic
934323217 2:91984773-91984795 GCCAGGGCCATGACAGAGCCAGG - Intergenic
934461531 2:94215564-94215586 GCCAGGGCCATGACAGAGCCAGG - Intergenic
945457584 2:210067138-210067160 ACCAGGGGGAGGAGGATGCCTGG - Intronic
948988862 2:241541768-241541790 AGCCGGGGGACGACGGTGCCCGG - Intergenic
1172257573 20:33532849-33532871 ACAAGGGAGAAGACAGTGCCAGG - Intronic
1173078403 20:39843019-39843041 ACCAGGGTCATGATGGTGCCAGG - Intergenic
1173844237 20:46177969-46177991 AAGAGGGCGATGAGGGCGCCGGG + Exonic
1176144877 20:63561104-63561126 ACCAGGGGGATGAGGGTTTCAGG + Exonic
1176376688 21:6090272-6090294 CCCAGGACGATCACGCTGCCAGG - Intergenic
1176592618 21:8658525-8658547 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1177730067 21:25017228-25017250 ACCAGTGCCATGACAGTTCCAGG - Intergenic
1179746787 21:43447972-43447994 CCCAGGACGATCACGCTGCCAGG + Intergenic
1180275474 22:10635667-10635689 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1180549964 22:16530644-16530666 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1181354713 22:22291192-22291214 GCCAGGGCTATGACAGAGCCAGG + Intergenic
1183591523 22:38781863-38781885 CCCAGAGCGATGAGGGTGGCTGG - Intronic
951382265 3:21998098-21998120 ACAAATGCCATGACGGTGCCTGG + Intronic
953005915 3:38979115-38979137 ACCAGGGCTATGACTATTCCTGG + Intergenic
977591050 4:98827611-98827633 ACCAGGGCTATAACGTTGCTGGG - Intergenic
981943797 4:150316984-150317006 ACCAGGGCCATGACCGTTCCAGG - Intronic
984875894 4:184367134-184367156 ACCAGTGCCATGACCGTTCCAGG - Intergenic
988585506 5:32504296-32504318 ACCAGTGCCATGACAGTTCCGGG + Intergenic
996502155 5:124229620-124229642 ACCAGCACCATGACGGTTCCCGG + Intergenic
997692307 5:135835029-135835051 ACCAGGGGGATCTCGGGGCCGGG - Intronic
998286751 5:140870193-140870215 ATCAGGGCAATGACCGTGCTGGG - Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1017219051 6:151944487-151944509 AACTGGGCGAAGAGGGTGCCAGG + Exonic
1018947627 6:168357819-168357841 AGCAGGCCCAGGACGGTGCCTGG + Intergenic
1035557720 8:579130-579152 ACCAAGGACATGACGGTGCCAGG + Intergenic
1036681486 8:10877728-10877750 ACCAGGGAGCTCACAGTGCCTGG - Intergenic
1038369174 8:26970447-26970469 ACCAGTGCCATGACAGTTCCAGG + Intergenic
1039973191 8:42338007-42338029 ACTAGGGCGCTGCCGGAGCCCGG - Intergenic
1042611840 8:70608421-70608443 ACCAGGGAGACGACGCTCCCTGG + Intergenic
1044819391 8:96145399-96145421 CCCAGGGCGCTGAGGGCGCCTGG + Exonic
1049567043 8:143345937-143345959 ACCAGGGAGATGCCGGGGGCAGG + Intronic
1049715216 8:144086607-144086629 ACCAAGGCGATGGCCTTGCCTGG - Intergenic
1053692007 9:40591217-40591239 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1054272793 9:63046268-63046290 GCCAGGGCCATGACAGAGCCAGG + Intergenic
1054303264 9:63392183-63392205 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1054402043 9:64718693-64718715 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1054435649 9:65203008-65203030 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1054494744 9:65818679-65818701 GCCAGGGCCATGACAGAGCCAGG + Intergenic
1057021034 9:91697737-91697759 ACCAGGGCCGTGACAGTGTCTGG - Intronic
1058525183 9:105850259-105850281 ACCAGGTAGATGATGGTGCCCGG - Intergenic
1062001709 9:134219214-134219236 ACACGGGTGGTGACGGTGCCGGG - Intergenic
1062094210 9:134694703-134694725 ACCAGGGAGATGAGGCTGCAGGG + Intronic
1203622671 Un_KI270749v1:137353-137375 GCCAGGGCCATGACAGAGCCAGG - Intergenic
1194977126 X:100407486-100407508 ACCAAGGCGATCACGTAGCCCGG + Exonic
1201190641 Y:11439761-11439783 GCCAGGGCCATGACAGAGCCAGG - Intergenic