ID: 1109062897

View in Genome Browser
Species Human (GRCh38)
Location 13:57641516-57641538
Sequence CCAATTTTATAGTCTATCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109062897 Original CRISPR CCAATTTTATAGTCTATCCC CGG (reversed) Intronic
901308080 1:8247898-8247920 TCAATTTTATGGCCTTTCCCTGG + Intergenic
920799156 1:209171409-209171431 CCATTTAAACAGTCTATCCCTGG + Intergenic
1068011838 10:51461803-51461825 CTAAGTTTATAGTCTGTCCCTGG + Intronic
1070482788 10:76901667-76901689 ACAATTTCATAGTCAGTCCCAGG + Intronic
1072765360 10:98090476-98090498 CCAAGTTTCTACTGTATCCCAGG - Intergenic
1073744240 10:106447253-106447275 CCAACTTCATGTTCTATCCCAGG + Intergenic
1075739996 10:124689472-124689494 GCCATTTTACAGTCCATCCCAGG - Intronic
1077646178 11:3927248-3927270 CCAATTTTTAAGTCTACCTCAGG + Intronic
1079540404 11:21565967-21565989 CTAATTTCATAGTCTATATCAGG + Intronic
1079977384 11:27108777-27108799 CCAATTTTATCCTCAATCCCAGG + Intronic
1081044416 11:38253561-38253583 CCACTTTTTTGTTCTATCCCTGG + Intergenic
1088761308 11:112931387-112931409 ACCATTTTATAGTCCTTCCCTGG + Intergenic
1092060273 12:5545197-5545219 CCAATCATATAGTCTATCTCGGG - Intronic
1098645532 12:72895768-72895790 CCAATTTTTTAGTCTGTCATGGG - Intergenic
1098746725 12:74246464-74246486 CCAGATTTATAGTTTCTCCCAGG + Intergenic
1109062897 13:57641516-57641538 CCAATTTTATAGTCTATCCCCGG - Intronic
1109447746 13:62466136-62466158 CCAAGTTAATAGTTTATACCAGG - Intergenic
1109924131 13:69111749-69111771 CAAATTTTATACTTTATCCAAGG - Intergenic
1110131473 13:72016972-72016994 CCAAGCTTATTGTCTCTCCCAGG - Intergenic
1110134490 13:72048523-72048545 CCAATTATATACTCTATTCATGG + Intergenic
1110449180 13:75622021-75622043 TCAACTTTGTAGACTATCCCCGG + Intronic
1111404719 13:87788533-87788555 CATATTTTATGGTCTCTCCCAGG - Intergenic
1111883295 13:93985846-93985868 CCGATTTTTTAGTTTAGCCCTGG - Intronic
1112818951 13:103308643-103308665 CTTATTTTTTAGTATATCCCTGG - Intergenic
1116599297 14:46898989-46899011 CTAATTTTATAGTGTCTCCAAGG - Intronic
1117067097 14:52021912-52021934 CCAGTTTTACAGCCTATTCCAGG - Intronic
1117106721 14:52404951-52404973 CCAACTTTATTCTCTATCTCAGG + Intergenic
1117777725 14:59199705-59199727 CCATTTTTGTATTCTAACCCAGG + Intronic
1117841589 14:59866333-59866355 CCCATTTTATTGTCTATCCCTGG - Intronic
1118879658 14:69815495-69815517 CCAACTTTACAGACTGTCCCTGG - Intergenic
1120112342 14:80572449-80572471 TCCATTTTATCGTCTATCTCTGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1125162457 15:36661591-36661613 CATGTTTTATAGTCTACCCCTGG + Intronic
1126176365 15:45739513-45739535 CCAATTTTCTCCTCCATCCCTGG + Intergenic
1126711534 15:51462227-51462249 GCAATTTTATACTTTATCTCGGG + Intronic
1128703842 15:69823487-69823509 CCAGTTTTATTGTCCATTCCTGG + Intergenic
1130172703 15:81532278-81532300 TCAATTTTATGATTTATCCCTGG + Intergenic
1135383950 16:22019676-22019698 CCAATTTTATTCCCTAGCCCAGG - Intronic
1137852160 16:51756532-51756554 CCAATTTTGAGGTCTGTCCCTGG - Intergenic
1141046786 16:80722785-80722807 TCAATTTTATAATCCATGCCAGG + Intronic
1143821525 17:9568123-9568145 ACAATTTTATAGTCTAGTTCAGG - Intronic
1144687942 17:17238373-17238395 CCACTTTTCTATTCTATTCCTGG - Intergenic
1146050246 17:29544929-29544951 CCAAATTTTAAGTCTTTCCCAGG + Exonic
1147550388 17:41437691-41437713 CCACTTGTCTAGTCTAACCCTGG - Intronic
1151010272 17:70485073-70485095 CCAAGTTTATACTTTCTCCCTGG - Intergenic
1153570049 18:6461852-6461874 CCTTATATATAGTCTATCCCGGG + Intergenic
1154360966 18:13659973-13659995 CCCATCTCATAGTCCATCCCAGG + Intergenic
1158288595 18:55913264-55913286 CCAATTTTGTAATCTATTCTAGG - Intergenic
1158665168 18:59426144-59426166 CCAATTTTCTAATCTATGCTGGG - Intergenic
1159996216 18:74967919-74967941 TAAATTTTATTGTCTTTCCCAGG + Intronic
924989958 2:305717-305739 ACAATTTTAGTGTCTGTCCCTGG + Intergenic
925164347 2:1706180-1706202 CCAATTTCATAGAATAACCCGGG - Intronic
929861342 2:45680498-45680520 CCAACTTTAAAGTTTAACCCTGG - Intronic
930402918 2:50913557-50913579 GTAATTGTATAGTCTATACCTGG + Intronic
937551400 2:123096590-123096612 CCAATTTCAAAGTCCAACCCAGG + Intergenic
942356546 2:175119293-175119315 CCAATTTTACAGGCTATAGCAGG + Intronic
943957899 2:194216593-194216615 CATATATTCTAGTCTATCCCAGG - Intergenic
1173881598 20:46417216-46417238 ACAAATTTATATTCTATCCCTGG + Intronic
1175037393 20:56013013-56013035 CTAATTTTAGAATCTAACCCTGG + Intergenic
950155314 3:10717286-10717308 CCATTTTTAATGTCCATCCCTGG - Intergenic
950317753 3:12019968-12019990 GCAATTTTTTTATCTATCCCTGG - Intronic
951492549 3:23288328-23288350 CCTAATATATAGTCTATCCTTGG + Intronic
954556315 3:51520217-51520239 CCAATTCTATTCTATATCCCAGG - Intergenic
954709597 3:52498817-52498839 CCAATTTCCTAGTCTCTCCCTGG + Intronic
956658805 3:71580565-71580587 TCAATTATGTAGGCTATCCCTGG + Intronic
957388481 3:79530249-79530271 CTAATTTTATACTTTCTCCCTGG + Intronic
957524843 3:81366991-81367013 CCAATTTTCCAGTCCATCCGGGG - Intergenic
959374986 3:105578551-105578573 CCATTTTTATTGTCTGTCTCTGG + Intergenic
964361932 3:155907757-155907779 GCAATTTTATAGGCTATTCAGGG + Intronic
965837242 3:172866031-172866053 CCAATTTTATAGTCTCCTGCAGG + Intergenic
966303824 3:178508731-178508753 CTAAATCTATAGTCTAACCCAGG - Intronic
975033264 4:69650317-69650339 TTAATTTTATAGTCTATCAGTGG + Intronic
981506150 4:145502110-145502132 TTAATTTTATTGACTATCCCAGG - Intronic
983233362 4:165151760-165151782 CCAAGCTTATTTTCTATCCCAGG + Intronic
983868241 4:172793704-172793726 CGAGTTTTATAGTCTGTCACTGG - Intronic
987253119 5:16120621-16120643 CCAGTTTTGCAGTCTACCCCAGG - Intronic
993698334 5:91088854-91088876 CAAATTTGATAGTCTATCATTGG + Intronic
994890848 5:105634046-105634068 CCAATTTTTAAGCCTATGCCAGG + Intergenic
998311008 5:141131680-141131702 CCAATTTAGTATTCTATCACAGG + Intronic
999139214 5:149346331-149346353 CTATTTTTATTCTCTATCCCAGG - Intronic
1000796280 5:165668819-165668841 CCAATTTTCTTGTCCATTCCAGG - Intergenic
1011367225 6:86596326-86596348 CTAAGTTTATAGTCTCTTCCTGG + Intergenic
1013880173 6:114888923-114888945 GCAATTATATAGTATATTCCTGG - Intergenic
1014040067 6:116816072-116816094 ACACTTTTATATTCCATCCCTGG + Intronic
1015713779 6:136169387-136169409 CCAATTTTCTAGCATTTCCCTGG + Intronic
1016633038 6:146254283-146254305 CCAATTTGATACTCTCTCCTGGG - Intronic
1017405037 6:154110427-154110449 CCAATCTTATATTCTTTCACGGG - Intronic
1017549106 6:155485581-155485603 CCAAGTTTATAGTTTGTCACAGG - Intergenic
1018331407 6:162731886-162731908 TCAATTTTGTAGGCAATCCCAGG + Intronic
1018954271 6:168397651-168397673 TCAATTTTATACTTTAACCCAGG + Intergenic
1019213145 6:170422412-170422434 CCATTTTTAAAGTCTATCAAAGG - Intergenic
1020422003 7:8017395-8017417 TCAATTTTTTAGTCTAACACTGG + Intronic
1020486066 7:8722236-8722258 CAGATTTTCTATTCTATCCCAGG - Intronic
1021824490 7:24535040-24535062 TCAATTTTAGAGTATATGCCAGG + Intergenic
1023374074 7:39538804-39538826 AGAATTTTATAGTCTAGGCCGGG + Intergenic
1026418674 7:70210093-70210115 CCAATTTTATAGTCATTTGCTGG + Intronic
1028736468 7:94218742-94218764 CCAATTTTACAATCTTTCCTAGG + Intergenic
1031622702 7:123954167-123954189 CCAATTTTATAGTCTCTACCAGG - Exonic
1035844165 8:2845187-2845209 CCTATTTTATAGTCGATGCATGG + Intergenic
1037272530 8:17145655-17145677 CCATTTTTTTAGTCTATCAGCGG + Intergenic
1043058522 8:75470643-75470665 CCTATTTTGTAGTCTGTCACTGG - Intronic
1046036341 8:108846209-108846231 CAAATTTTATCCTGTATCCCAGG - Intergenic
1047399884 8:124537426-124537448 CCACTTTTCTAGCCCATCCCTGG - Intronic
1048750417 8:137667201-137667223 ACAATTTTATATTATATCACTGG - Intergenic
1049200306 8:141336835-141336857 CCAAGTTGATACTCTCTCCCAGG - Intergenic
1055751667 9:79513469-79513491 TCAAGTTTATAGTCTATCTGGGG + Intergenic
1055802946 9:80060490-80060512 CCATTTTTATAGCCTATCAAAGG + Intergenic
1058115025 9:101075787-101075809 CCTATTTTATTTTCTATCCCTGG - Intronic
1058167414 9:101635787-101635809 CTGATTTTAGATTCTATCCCAGG + Intronic
1059067345 9:111099411-111099433 CCGATTATATACTCTGTCCCAGG + Intergenic
1059454542 9:114391342-114391364 CCAATTTTATAGTGAGGCCCTGG + Intronic
1059848210 9:118305099-118305121 CCTATTTTATATTCTATCTTTGG + Intergenic
1186750009 X:12611645-12611667 CAAATTTTAAAATCTATACCAGG - Intronic
1190125092 X:47697877-47697899 CCATTTTTATAGTTTTTCCAGGG - Intergenic
1190952121 X:55156354-55156376 CCTAATACATAGTCTATCCCTGG + Intronic
1194047697 X:89029667-89029689 CCAATTTTATGGTGTATTTCAGG + Intergenic
1195393617 X:104388188-104388210 CCATTTTTATAGACCATCCATGG + Intergenic