ID: 1109063571

View in Genome Browser
Species Human (GRCh38)
Location 13:57653027-57653049
Sequence AACCTCTTGAAACTACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109063571_1109063572 20 Left 1109063571 13:57653027-57653049 CCTGGCAGTAGTTTCAAGAGGTT 0: 1
1: 0
2: 0
3: 14
4: 119
Right 1109063572 13:57653070-57653092 GTAAAAGTATTCACAAATTTTGG 0: 1
1: 0
2: 2
3: 27
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109063571 Original CRISPR AACCTCTTGAAACTACTGCC AGG (reversed) Intronic
901230507 1:7639423-7639445 AATCTCTGGAAACTCCTCCCTGG - Intronic
901766780 1:11505158-11505180 AATCACCTGAAAATACTGCCAGG - Intronic
902105110 1:14028716-14028738 AACCTTTTGAAACTATGGACAGG - Intergenic
903273830 1:22208473-22208495 AACCTCTGGCAAGTGCTGCCCGG - Intergenic
903666812 1:25013054-25013076 AGACTCTTGAACCTGCTGCCCGG - Intergenic
903863691 1:26381863-26381885 AACCTATTGAAACTAATGCAAGG + Intergenic
908918128 1:69157194-69157216 AACCCATTGCAACCACTGCCAGG - Intergenic
912014747 1:105018621-105018643 AACCTCATGACACCACTACCAGG + Intergenic
912093570 1:106112744-106112766 GACCTCGTGATACTCCTGCCTGG + Intergenic
913242561 1:116841894-116841916 AAAGTCTTGCAGCTACTGCCTGG - Intergenic
917707327 1:177647645-177647667 ATCCTCTTAAGACTGCTGCCTGG - Intergenic
918104125 1:181401845-181401867 CTCCTCTTGGAATTACTGCCTGG + Intergenic
921649440 1:217659008-217659030 AACCTGATGATATTACTGCCTGG + Intronic
1063402941 10:5765215-5765237 AAATTCTGGAAACTACTGCCCGG - Exonic
1064524379 10:16238816-16238838 AATCTCTCTAAACTACTGCCTGG - Intergenic
1067050352 10:43013008-43013030 AACCTCTTGAGACTGTTCCCTGG + Intergenic
1073230311 10:101963769-101963791 GACCTTTTAAAACTACTACCAGG - Intronic
1073237964 10:102034734-102034756 GACCTTTTAAAACTACTACCAGG + Intronic
1077780018 11:5317297-5317319 AGCCACTTGAAACTACTACAAGG - Intronic
1077870488 11:6258539-6258561 AACCTCTTACAGCTACTGCTGGG + Intergenic
1081082536 11:38760260-38760282 AACCTCTGAACATTACTGCCTGG - Intergenic
1081212501 11:40354315-40354337 AACCTCTGGCAACCACTGCCAGG + Intronic
1084164054 11:67366936-67366958 AACCCCCTGCCACTACTGCCTGG + Intronic
1086885852 11:92204908-92204930 CACTTCTTGAAACTAGTGCCAGG - Intergenic
1086949470 11:92876940-92876962 GACCTTTTGTAACTACTGCAAGG - Intronic
1093750573 12:22794377-22794399 ATCCTCATAAAACTATTGCCAGG + Intergenic
1095448026 12:42301984-42302006 AACTTCTTGAAAATACTGTCAGG + Intronic
1099673071 12:85719126-85719148 AACCTCTTGAAACCTCTTCTAGG + Intergenic
1101251874 12:102945254-102945276 GACCTGTGGCAACTACTGCCTGG + Intronic
1102469985 12:113154403-113154425 AACCTCTTGGAACTAGAGTCGGG - Exonic
1105481520 13:20781979-20782001 AACATCTTGAAAAGACTGCTAGG - Exonic
1106502871 13:30346206-30346228 ATCTCCTTGAAACTGCTGCCAGG - Intergenic
1108651157 13:52481219-52481241 AATCTCCTGAAACTTCTTCCTGG + Intergenic
1109063571 13:57653027-57653049 AACCTCTTGAAACTACTGCCAGG - Intronic
1110063217 13:71067643-71067665 GACCTGTGGCAACTACTGCCTGG + Intergenic
1110936369 13:81295063-81295085 AAGCTACTGAATCTACTGCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114170521 14:20268557-20268579 ATCCTCTTGATACTAAAGCCAGG + Intronic
1115407228 14:33031248-33031270 AACATCTTGAAACAACTTCATGG + Intronic
1116622826 14:47227400-47227422 AACCTCGTGAAACCACATCCTGG + Intronic
1117020452 14:51565182-51565204 AAGTTCTTGACACTAATGCCTGG + Intronic
1118104988 14:62648621-62648643 AGCTTCATGAAACTAATGCCAGG - Intergenic
1122820397 14:104341843-104341865 CACCTCTTGATACTATTGCATGG + Intergenic
1129924200 15:79348106-79348128 AACTTATTGAAAATATTGCCTGG - Intronic
1130285422 15:82550570-82550592 CCCCTCTTGTAACTTCTGCCAGG - Intronic
1130935984 15:88470855-88470877 AACCTCTTGAACCCACCTCCTGG - Intronic
1131135925 15:89935387-89935409 ACCATATCGAAACTACTGCCTGG + Intergenic
1131514910 15:93070984-93071006 TACCTCTGGAAACTTCTGCCAGG + Intronic
1132651878 16:1025011-1025033 AATCTCTTCAAGGTACTGCCGGG + Intergenic
1137928569 16:52564881-52564903 AACTTTTTTAAACTACTGCCTGG - Intergenic
1140337814 16:74126614-74126636 AACATCTTTAAAATACTGGCTGG + Intergenic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1155634847 18:27940368-27940390 GACCTTTTGAAAATACTGCCTGG - Intergenic
1157070057 18:44396180-44396202 AGCTTCTTGAAACTACAGCCTGG + Intergenic
1162088078 19:8260505-8260527 AACTCCTTGAAAGTACTGGCTGG - Intronic
1166193756 19:41193394-41193416 AACCTCCTGCAGCTACGGCCCGG + Exonic
1166330099 19:42073100-42073122 AACCACTTGAACTTCCTGCCTGG + Intronic
1166609924 19:44182106-44182128 AAACTGTTGAAACTATTCCCAGG - Intergenic
1168582939 19:57570393-57570415 ATCCTCTTGCACATACTGCCTGG - Intergenic
925049146 2:797659-797681 CACCTCTAGAAACTACTGCAGGG - Intergenic
925997308 2:9303980-9304002 GACCTCTGGCAACTCCTGCCTGG + Intronic
928939969 2:36717722-36717744 AGCATTGTGAAACTACTGCCAGG + Intronic
933409701 2:81909997-81910019 CACCTCTAGACACTACTGCAGGG - Intergenic
936065005 2:109324364-109324386 AGCCACTTGGAACAACTGCCTGG - Intronic
938829962 2:135040485-135040507 CACCTCTTGAAACCACTTCTAGG + Intronic
942811756 2:180008163-180008185 CAATTCTTAAAACTACTGCCTGG - Intergenic
942947808 2:181688371-181688393 AACTTCTTTAAAAAACTGCCAGG - Intergenic
1169521032 20:6373053-6373075 AACCTTTTCAAACTAGAGCCAGG + Intergenic
1169599347 20:7239716-7239738 AACCTCCTGAAACTCATGTCAGG + Intergenic
1170537895 20:17359550-17359572 AAACTCTTAAAGCTTCTGCCTGG + Intronic
1174902041 20:54510474-54510496 AATCTCTTTAAACCACAGCCAGG + Intronic
1182623230 22:31629182-31629204 AACCTGTAGTAACTGCTGCCTGG - Intronic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
952598549 3:35049450-35049472 AACCATTTGAAACTAATGACAGG + Intergenic
953679806 3:45030652-45030674 AACCACTTGTGACTTCTGCCAGG - Intronic
955510389 3:59674865-59674887 AACCTCTTTTAACCACTGACAGG - Intergenic
957965936 3:87322282-87322304 AACCCATTGTAACTACTACCTGG - Intergenic
958026395 3:88055079-88055101 AGCCTATTGAAGCTGCTGCCAGG - Exonic
958156623 3:89762940-89762962 CACCTCCTAAAACTATTGCCTGG - Intergenic
959433102 3:106279174-106279196 AACCTATTGAAACTAGTGTCAGG - Intergenic
960178510 3:114546351-114546373 TACCTCTGAAAACTATTGCCTGG + Intronic
960667217 3:120121885-120121907 AACATCTTAAAAGTACTGCAAGG + Intergenic
963383471 3:144560365-144560387 AACCAGTTGAAATTACTGCACGG + Intergenic
963513852 3:146283022-146283044 AACCTCATGATTCTACTACCTGG - Intergenic
966825895 3:183964746-183964768 AGCCTCTGGAAACTGCTGCAGGG + Intronic
967733446 3:192927659-192927681 AGCCTCTTGTAAATACTTCCTGG - Intergenic
977480507 4:97568814-97568836 AACCCCTTCAAACAACTGCTAGG - Intronic
979983033 4:127279952-127279974 AACCTCTTGAAACCTCTTACAGG + Intergenic
980403867 4:132331068-132331090 AACCTCTAGAGCCTACTGGCTGG - Intergenic
983625902 4:169801694-169801716 AACCTCTTGAGACTGTTCCCTGG - Intergenic
984098017 4:175455253-175455275 AACCCCTGGACACTGCTGCCAGG - Intergenic
984962214 4:185108919-185108941 AACCTCTTGAAACTGTTCCCTGG - Intergenic
986046689 5:4044759-4044781 AAGCCCATGAAAATACTGCCAGG - Intergenic
986435478 5:7726162-7726184 AACCTCCTGAAAATACTGTCAGG - Intronic
986945834 5:13018239-13018261 AACCTTATGAAACTAGTGCAAGG + Intergenic
987255275 5:16143854-16143876 AACCTCTTCCAAATACTGGCAGG + Intronic
988458340 5:31408799-31408821 AATCTCTGTGAACTACTGCCTGG - Intronic
993009956 5:82469600-82469622 AAACTCTTGAAAATACTCCATGG + Intergenic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
1000630504 5:163585638-163585660 AACCTCTCCCAACTGCTGCCAGG - Intergenic
1000976695 5:167772803-167772825 ACCTCCTTGAAACTACTGACAGG + Intronic
1005801782 6:29432518-29432540 TACCTATTGAAACAATTGCCTGG - Intronic
1006498202 6:34439408-34439430 AACCTCTTTAAACTACTTTATGG + Intergenic
1007360194 6:41349965-41349987 AAACTCTTGAAAGTGCTACCTGG - Intronic
1007431114 6:41777858-41777880 AACCCCTTAAAACTTCTGCTTGG - Intronic
1010587119 6:77666435-77666457 ATCCACTTGAGACTACTGTCAGG - Intergenic
1012973897 6:105759125-105759147 GACCTCTTGAATGTACTACCTGG + Intergenic
1016182135 6:141159983-141160005 GACCTCTTGAGACTGCTCCCTGG + Intergenic
1018322550 6:162627320-162627342 AACCTCTTAAAACATCTTCCAGG - Intronic
1019144035 6:169965444-169965466 AAGATCTTCAAACTCCTGCCAGG - Intergenic
1019265438 7:114416-114438 AAGCTCTGCAAAGTACTGCCGGG + Intergenic
1020909928 7:14116178-14116200 GACCTCTTGAGACTGCTTCCCGG + Intergenic
1026252319 7:68681738-68681760 AAACTCCTGAAACTCCTTCCAGG - Intergenic
1028316845 7:89412923-89412945 AACCTCTGGCAACAACTGACTGG + Intergenic
1030137538 7:106270617-106270639 AACCTCTTGAAACTGGGGCTTGG - Intronic
1031854088 7:126900902-126900924 ATCCTCTTCACACTTCTGCCAGG + Intronic
1032236923 7:130132652-130132674 AACCTCCTGCCACCACTGCCAGG + Exonic
1033684617 7:143626952-143626974 ATTATCTTGAAACTCCTGCCAGG - Intronic
1033687793 7:143706171-143706193 ATTATCTTGAAACTCCTGCCAGG - Intronic
1033699994 7:143830671-143830693 ATTATCTTGAAACTCCTGCCAGG + Intergenic
1034702612 7:153109402-153109424 AACCTTTTGAAGTCACTGCCAGG - Intergenic
1035885045 8:3282378-3282400 AACCTGTTGAAAAAAATGCCTGG + Intronic
1038272458 8:26086505-26086527 ATCCTGTTCACACTACTGCCAGG - Intergenic
1038534916 8:28347051-28347073 AACATCATGACCCTACTGCCAGG + Exonic
1046333608 8:112754449-112754471 AAACACTTGAAATTACTGCTGGG - Intronic
1051990996 9:23152952-23152974 AATCTGTTGTAACTACTACCTGG + Intergenic
1055702361 9:78959214-78959236 AACCTTAAGAAATTACTGCCAGG - Intergenic
1055917149 9:81416090-81416112 AACCTATTGATAGTAATGCCTGG + Intergenic
1057425509 9:94946235-94946257 AACCTCTTGACTCTACTGAATGG + Intronic
1059454617 9:114391900-114391922 AACCTCTTACTCCTACTGCCAGG + Intronic
1187409328 X:19035217-19035239 AGACTCTTGATACTACTGCTTGG - Intronic
1194112298 X:89849672-89849694 AATCCCTTGTAACTATTGCCTGG - Intergenic
1196217498 X:113071345-113071367 GACCTGCTGTAACTACTGCCTGG + Intergenic
1200464953 Y:3504476-3504498 AATCCCTTGTAACTATTGCCTGG - Intergenic