ID: 1109066770

View in Genome Browser
Species Human (GRCh38)
Location 13:57704860-57704882
Sequence TGTAGGATCTGCACTTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109066766_1109066770 29 Left 1109066766 13:57704808-57704830 CCATTAGGTTTAATCACTTTGAG 0: 1
1: 0
2: 1
3: 14
4: 173
Right 1109066770 13:57704860-57704882 TGTAGGATCTGCACTTGCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109066770 Original CRISPR TGTAGGATCTGCACTTGCTA AGG Intronic
900678908 1:3905394-3905416 TGTAGGCTCTGAGCCTGCTAGGG + Intergenic
905981179 1:42229688-42229710 TGTAGCATCTGCATTTTATAGGG - Intronic
907102316 1:51848002-51848024 TGTAGGTTCTTAATTTGCTAAGG - Intronic
909829241 1:80164873-80164895 TGTAGGAACTTGACTTGCAAGGG - Intergenic
921223664 1:212995175-212995197 TGTAGGAGCTGAAGTTGCTTTGG - Exonic
923809834 1:237301398-237301420 TGTAGGAACTTCATTTACTATGG + Intronic
1063698590 10:8362321-8362343 TAGAGGATGTGCACTTGCTGGGG - Intergenic
1064896306 10:20241392-20241414 TGGAGGACCAGAACTTGCTAAGG - Intronic
1071709273 10:88033527-88033549 GGGAGGATCTGCACGTGTTAGGG - Intergenic
1081559368 11:44198807-44198829 AGTAGTATCTGCACTTTTTATGG + Intronic
1097103598 12:56606902-56606924 TGTAGGAGAGGCACCTGCTATGG + Intronic
1100364824 12:93910531-93910553 TCTAGGAACTGCAGTTGCTGTGG - Intergenic
1102965432 12:117121630-117121652 TGCAGGATCTGCGGGTGCTATGG + Intergenic
1109066770 13:57704860-57704882 TGTAGGATCTGCACTTGCTAAGG + Intronic
1111553975 13:89855259-89855281 TGTAGGATGTGCAATATCTATGG - Intergenic
1112307564 13:98288945-98288967 TGTAGGAACAGCAGTTCCTATGG + Intronic
1121501703 14:94443201-94443223 TGTTGGATTTGCACTTGCCAAGG - Exonic
1128956147 15:71947751-71947773 TGAAGGATCAGCAATTGCCAGGG - Intronic
1129309604 15:74696752-74696774 TGTAAAATCTACACTTTCTAGGG + Intergenic
1130018643 15:80208386-80208408 TGTACAATCTGCACATGCTGGGG + Intergenic
1131957943 15:97757731-97757753 TGGAGGATCTGCATTGGCTGCGG - Intergenic
1137906964 16:52333007-52333029 TGAAGGACCTGCACTTGGTGAGG - Intergenic
1138912031 16:61412731-61412753 TGATTGATCTTCACTTGCTATGG + Intergenic
1142501199 17:334432-334454 AGAAGGAGCTGCACTTGCTGGGG - Intronic
1149609934 17:57952883-57952905 TGTGGCATCTACACTTGCTAGGG - Intronic
1150457327 17:65317342-65317364 AGTAGGAGCTGCACTTACTCTGG + Intergenic
1153094209 18:1382801-1382823 TGTGGGATCTCCTCTTGCTGGGG - Intergenic
1153753850 18:8260672-8260694 TGTAGGATATGCTGGTGCTATGG - Intronic
1156484293 18:37455258-37455280 TGGATGCTCTGCACTTGGTATGG - Intronic
1159235046 18:65660407-65660429 TTTAGGATCTTCACTTGAAAAGG - Intergenic
1160038333 18:75321536-75321558 TGGTGGACCTGCACTTTCTAGGG + Intergenic
1166752782 19:45172656-45172678 GGCAGGATCTGGACTTGCTCAGG - Intronic
1167035157 19:46990864-46990886 TCCAGGGTCTGCACTTCCTATGG + Intronic
927906805 2:26864399-26864421 TTTGGGATCTGCACCTGCTCTGG - Intronic
931966739 2:67543739-67543761 TGTGGGATGTGCAGTAGCTAGGG + Intergenic
934153395 2:89171822-89171844 TGTAGGTTCTGCCCATGCTAAGG + Intergenic
934213841 2:90010109-90010131 TGTAGGTTCTGCCCATGCTAAGG - Intergenic
934767664 2:96889066-96889088 TGTGGGTTCTGCACCTGTTATGG - Intronic
939383377 2:141465283-141465305 TGTGGGATATGCAGTGGCTAGGG + Intronic
940966176 2:159839492-159839514 TCTAGGATCAGCACTTGAGATGG + Intronic
942226276 2:173819138-173819160 TGTAGTATCTGCATATGGTAAGG + Intergenic
943165229 2:184314100-184314122 TGGAGGATCTGCAACTGTTAGGG - Intergenic
946665892 2:222049766-222049788 TGTAGGATCTGGACTTTGGATGG - Intergenic
948129776 2:235591947-235591969 AGCAGCATCTGCTCTTGCTAAGG - Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1178726280 21:35054431-35054453 TTTAATATCTGCACTTGCCAGGG + Intronic
1181674664 22:24443956-24443978 CCTAGGATCTGCACTGGCTGTGG + Intergenic
1182423517 22:30259998-30260020 TGTAGGATCTGGCCTTGGGAGGG + Intergenic
1183503752 22:38196949-38196971 TGTAGGATCAGCACTGGCATTGG - Intronic
1203225885 22_KI270731v1_random:78204-78226 GGTAGGATCTGCTCTTGTTTTGG + Intergenic
1203264942 22_KI270734v1_random:8579-8601 GGTAGGATCTGCTCTTGTTTTGG - Intergenic
951432199 3:22621387-22621409 TGTAGAATGTGAACATGCTAAGG - Intergenic
960852430 3:122069830-122069852 TGTTGGTTCTCCACTTGCTGCGG + Intronic
964155221 3:153576914-153576936 TTTAGGATATGCACTTGCCCAGG + Intergenic
969637301 4:8376806-8376828 GGCAGGATCTGGACTTGCTCTGG + Intronic
970835710 4:20403775-20403797 TGTAAGATCTGCACCTGCAAGGG - Intronic
972073465 4:35054112-35054134 TGATGCATCTACACTTGCTAAGG - Intergenic
976708390 4:88042499-88042521 AGTAGGATCTGGACTTGCACAGG - Intronic
983670364 4:170230466-170230488 TGAAGGATATGCTATTGCTAAGG - Intergenic
985965441 5:3335945-3335967 TGTGGGGTCTGCATTTGCTGTGG + Intergenic
989152867 5:38317553-38317575 TCTGGGATATGAACTTGCTAGGG - Intronic
993258954 5:85633373-85633395 TGAAGGATCTGCTCTTGCCAAGG + Intergenic
994964309 5:106648283-106648305 CTTAGGATATTCACTTGCTATGG - Intergenic
997791264 5:136764544-136764566 AGTAGGATAAGCACCTGCTATGG - Intergenic
1000478294 5:161740170-161740192 TTTAGCATCTAGACTTGCTAAGG + Intergenic
1004907373 6:20248825-20248847 TGCAGGCTCTGCAAATGCTAAGG - Intergenic
1007869332 6:45015420-45015442 TGTAGGACCTGAAGTTGCTCTGG + Intronic
1011584618 6:88910918-88910940 TGCAGGATTAGCAATTGCTAAGG + Intronic
1013134455 6:107267321-107267343 TGTCAGATCTGCACTTTCTGAGG + Intronic
1013652150 6:112206274-112206296 TGTGGGATCTGCACTGACTGTGG + Intronic
1015298959 6:131631378-131631400 TGTTGGATCTCCACTTGCTGAGG + Intronic
1016141877 6:140622460-140622482 TGTTGGTTCTGCTCTTGCAAAGG + Intergenic
1020444487 7:8255067-8255089 TGTAGGAGCTGTCCTTCCTAGGG - Intronic
1028844436 7:95463374-95463396 TGGAGGATCTGTGATTGCTATGG + Intergenic
1029254871 7:99262835-99262857 TGTAGGGTCTCTCCTTGCTAGGG - Intergenic
1033452828 7:141476979-141477001 TGTAGGAGTTGCATTTGCTGAGG - Exonic
1036126631 8:6068934-6068956 TGAACGATGTGCAGTTGCTAAGG - Intergenic
1038478759 8:27887063-27887085 TGGAGCATCTGCTCTTGCTTTGG - Intronic
1041158454 8:55012084-55012106 TGTGGGGTCTGCACTAGCTCTGG - Intergenic
1047244193 8:123124477-123124499 AGTAGGATATCCTCTTGCTAAGG + Intronic
1049558936 8:143297753-143297775 TGTGGGTTCTGCACTAGCTCCGG + Exonic
1051277357 9:15409425-15409447 TTTAGGGTATGCAGTTGCTATGG - Intergenic
1051734383 9:20183622-20183644 TGCAGGATATGCACTTGCTCTGG + Intergenic
1051954155 9:22669593-22669615 TGTGGGATCTGCACTAACTCTGG + Intergenic
1052161943 9:25273086-25273108 TGTAGCATCTGCTCTTGGTGAGG - Intergenic
1052496943 9:29239167-29239189 TGAAGCATCTACAGTTGCTAAGG - Intergenic
1056277728 9:85009517-85009539 TGTAGCATGTGCACTTTTTATGG + Intronic
1057720009 9:97524605-97524627 AGCAAGATCTGCAGTTGCTAAGG + Intronic
1058560824 9:106227077-106227099 TGTCAGTTCTCCACTTGCTATGG + Intergenic
1058864999 9:109153712-109153734 TGTGGGATCTGCACTAACTCTGG + Intronic
1059284299 9:113159686-113159708 TGTGGGATCTGCACTAACTCTGG - Intronic
1060039692 9:120289215-120289237 TGAAGGAGCAGCACTTGCCAGGG + Intergenic
1062543577 9:137052144-137052166 AGAAGGACCTGCACTGGCTAAGG + Intronic
1187930740 X:24291634-24291656 TGTAGGAGATGCACTTGCCAAGG + Intergenic
1189657252 X:43257904-43257926 TGTAAGATGTGCACGTGCTCAGG - Intergenic
1192713190 X:73613524-73613546 TGTAGTATCTGCTCTTGGTGAGG - Intronic
1195418908 X:104651812-104651834 TGTAGGCTCTGAACTTTCAAAGG - Intronic
1195580555 X:106496453-106496475 TGTACAATCTTCACCTGCTATGG + Intergenic