ID: 1109073365

View in Genome Browser
Species Human (GRCh38)
Location 13:57799583-57799605
Sequence GTCACTTATGTCACTACATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109073361_1109073365 -2 Left 1109073361 13:57799562-57799584 CCGATGACTGTCCCAATTTCAGT No data
Right 1109073365 13:57799583-57799605 GTCACTTATGTCACTACATTGGG No data
1109073360_1109073365 7 Left 1109073360 13:57799553-57799575 CCTATTTGTCCGATGACTGTCCC No data
Right 1109073365 13:57799583-57799605 GTCACTTATGTCACTACATTGGG No data
1109073359_1109073365 19 Left 1109073359 13:57799541-57799563 CCAGGTGGAGAGCCTATTTGTCC No data
Right 1109073365 13:57799583-57799605 GTCACTTATGTCACTACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109073365 Original CRISPR GTCACTTATGTCACTACATT GGG Intergenic
No off target data available for this crispr