ID: 1109074932

View in Genome Browser
Species Human (GRCh38)
Location 13:57822694-57822716
Sequence CAGTTACAGAAGAATGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109074929_1109074932 28 Left 1109074929 13:57822643-57822665 CCTTGGGGAGGTCATTGTTCATA No data
Right 1109074932 13:57822694-57822716 CAGTTACAGAAGAATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109074932 Original CRISPR CAGTTACAGAAGAATGAGTG TGG Intergenic
No off target data available for this crispr