ID: 1109076943

View in Genome Browser
Species Human (GRCh38)
Location 13:57847546-57847568
Sequence CTGTATTTTCAAATAATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109076943_1109076944 -1 Left 1109076943 13:57847546-57847568 CCTGGCATTATTTGAAAATACAG No data
Right 1109076944 13:57847568-57847590 GAAGAAATTCTAAGATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109076943 Original CRISPR CTGTATTTTCAAATAATGCC AGG (reversed) Intergenic
No off target data available for this crispr