ID: 1109077864

View in Genome Browser
Species Human (GRCh38)
Location 13:57861121-57861143
Sequence ATCATGAAGCTAATGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109077864_1109077868 24 Left 1109077864 13:57861121-57861143 CCTTCCAGCATTAGCTTCATGAT No data
Right 1109077868 13:57861168-57861190 GAACTTCTATGCAAAAGGTAGGG No data
1109077864_1109077867 23 Left 1109077864 13:57861121-57861143 CCTTCCAGCATTAGCTTCATGAT No data
Right 1109077867 13:57861167-57861189 AGAACTTCTATGCAAAAGGTAGG No data
1109077864_1109077866 19 Left 1109077864 13:57861121-57861143 CCTTCCAGCATTAGCTTCATGAT No data
Right 1109077866 13:57861163-57861185 TCTTAGAACTTCTATGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109077864 Original CRISPR ATCATGAAGCTAATGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr