ID: 1109081953

View in Genome Browser
Species Human (GRCh38)
Location 13:57914847-57914869
Sequence CATGATAAGTAGAAATTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109081950_1109081953 14 Left 1109081950 13:57914810-57914832 CCAAGAGAACAAAATAAATGCAC No data
Right 1109081953 13:57914847-57914869 CATGATAAGTAGAAATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109081953 Original CRISPR CATGATAAGTAGAAATTTGA GGG Intergenic
No off target data available for this crispr