ID: 1109093754

View in Genome Browser
Species Human (GRCh38)
Location 13:58084235-58084257
Sequence CCAGTTGGATACTTTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109093754_1109093761 24 Left 1109093754 13:58084235-58084257 CCAGGATCAAAGTATCCAACTGG No data
Right 1109093761 13:58084282-58084304 CAAGCCCTTTCTAGAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109093754 Original CRISPR CCAGTTGGATACTTTGATCC TGG (reversed) Intergenic
No off target data available for this crispr