ID: 1109095276

View in Genome Browser
Species Human (GRCh38)
Location 13:58106499-58106521
Sequence ATGCCTATGCTGAAGGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109095276_1109095279 7 Left 1109095276 13:58106499-58106521 CCAACAACCTTCAGCATAGGCAT No data
Right 1109095279 13:58106529-58106551 ATCATGAGTATGTCACAGTGCGG No data
1109095276_1109095280 25 Left 1109095276 13:58106499-58106521 CCAACAACCTTCAGCATAGGCAT No data
Right 1109095280 13:58106547-58106569 TGCGGCAGAGATTTTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109095276 Original CRISPR ATGCCTATGCTGAAGGTTGT TGG (reversed) Intergenic
No off target data available for this crispr