ID: 1109099595

View in Genome Browser
Species Human (GRCh38)
Location 13:58163778-58163800
Sequence GGAGGGGCATGAGACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109099588_1109099595 4 Left 1109099588 13:58163751-58163773 CCAAGCTTTAGGCATGAGTGGGG No data
Right 1109099595 13:58163778-58163800 GGAGGGGCATGAGACTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109099595 Original CRISPR GGAGGGGCATGAGACTGTAA AGG Intergenic
No off target data available for this crispr