ID: 1109104219

View in Genome Browser
Species Human (GRCh38)
Location 13:58229352-58229374
Sequence GTTGGTTTCATAACAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109104219_1109104223 9 Left 1109104219 13:58229352-58229374 CCAGATGTTGTTATGAAACCAAC No data
Right 1109104223 13:58229384-58229406 ACTGATGAAAAAAAAAGTGGAGG No data
1109104219_1109104222 6 Left 1109104219 13:58229352-58229374 CCAGATGTTGTTATGAAACCAAC No data
Right 1109104222 13:58229381-58229403 TTAACTGATGAAAAAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109104219 Original CRISPR GTTGGTTTCATAACAACATC TGG (reversed) Intergenic
No off target data available for this crispr