ID: 1109111367

View in Genome Browser
Species Human (GRCh38)
Location 13:58323584-58323606
Sequence TTTTAAACACAGAAAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109111365_1109111367 -10 Left 1109111365 13:58323571-58323593 CCAATAATTGAAATTTTAAACAC No data
Right 1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG No data
1109111364_1109111367 13 Left 1109111364 13:58323548-58323570 CCATTGACATTAGGAAAGGCTAT No data
Right 1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109111367 Original CRISPR TTTTAAACACAGAAAGTGTA GGG Intergenic
No off target data available for this crispr