ID: 1109117158

View in Genome Browser
Species Human (GRCh38)
Location 13:58402721-58402743
Sequence AACTGAAGACCATTATCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109117158_1109117163 22 Left 1109117158 13:58402721-58402743 CCCTAGGATAATGGTCTTCAGTT No data
Right 1109117163 13:58402766-58402788 CATGATTTTATTGTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109117158 Original CRISPR AACTGAAGACCATTATCCTA GGG (reversed) Intergenic
No off target data available for this crispr