ID: 1109117163

View in Genome Browser
Species Human (GRCh38)
Location 13:58402766-58402788
Sequence CATGATTTTATTGTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109117159_1109117163 21 Left 1109117159 13:58402722-58402744 CCTAGGATAATGGTCTTCAGTTC No data
Right 1109117163 13:58402766-58402788 CATGATTTTATTGTTTTCTCTGG No data
1109117160_1109117163 -1 Left 1109117160 13:58402744-58402766 CCATCCATGTTCCTGCAAAATAC No data
Right 1109117163 13:58402766-58402788 CATGATTTTATTGTTTTCTCTGG No data
1109117158_1109117163 22 Left 1109117158 13:58402721-58402743 CCCTAGGATAATGGTCTTCAGTT No data
Right 1109117163 13:58402766-58402788 CATGATTTTATTGTTTTCTCTGG No data
1109117161_1109117163 -5 Left 1109117161 13:58402748-58402770 CCATGTTCCTGCAAAATACATGA 0: 18
1: 278
2: 2078
3: 12131
4: 28608
Right 1109117163 13:58402766-58402788 CATGATTTTATTGTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109117163 Original CRISPR CATGATTTTATTGTTTTCTC TGG Intergenic
No off target data available for this crispr