ID: 1109121552

View in Genome Browser
Species Human (GRCh38)
Location 13:58464105-58464127
Sequence TGCACATTGTTAAATGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109121552_1109121556 5 Left 1109121552 13:58464105-58464127 CCAGTAGCATTTAACAATGTGCA No data
Right 1109121556 13:58464133-58464155 AGCTAACACCAAGGGGCCAATGG No data
1109121552_1109121557 6 Left 1109121552 13:58464105-58464127 CCAGTAGCATTTAACAATGTGCA No data
Right 1109121557 13:58464134-58464156 GCTAACACCAAGGGGCCAATGGG No data
1109121552_1109121555 -2 Left 1109121552 13:58464105-58464127 CCAGTAGCATTTAACAATGTGCA No data
Right 1109121555 13:58464126-58464148 CAGCAACAGCTAACACCAAGGGG No data
1109121552_1109121554 -3 Left 1109121552 13:58464105-58464127 CCAGTAGCATTTAACAATGTGCA No data
Right 1109121554 13:58464125-58464147 GCAGCAACAGCTAACACCAAGGG No data
1109121552_1109121553 -4 Left 1109121552 13:58464105-58464127 CCAGTAGCATTTAACAATGTGCA No data
Right 1109121553 13:58464124-58464146 TGCAGCAACAGCTAACACCAAGG No data
1109121552_1109121558 11 Left 1109121552 13:58464105-58464127 CCAGTAGCATTTAACAATGTGCA No data
Right 1109121558 13:58464139-58464161 CACCAAGGGGCCAATGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109121552 Original CRISPR TGCACATTGTTAAATGCTAC TGG (reversed) Intergenic
No off target data available for this crispr