ID: 1109131940

View in Genome Browser
Species Human (GRCh38)
Location 13:58597937-58597959
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109131940_1109131946 4 Left 1109131940 13:58597937-58597959 CCATCACTCTAACCCAGTAGTTC No data
Right 1109131946 13:58597964-58597986 TTTACTTATTTTGCCCCCTAGGG No data
1109131940_1109131945 3 Left 1109131940 13:58597937-58597959 CCATCACTCTAACCCAGTAGTTC No data
Right 1109131945 13:58597963-58597985 ATTTACTTATTTTGCCCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109131940 Original CRISPR GAACTACTGGGTTAGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr