ID: 1109134147

View in Genome Browser
Species Human (GRCh38)
Location 13:58625772-58625794
Sequence CCTTCTGCCCTGCTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109134142_1109134147 12 Left 1109134142 13:58625737-58625759 CCACCTGTGTGCAGTCTGGGGGT No data
Right 1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG No data
1109134143_1109134147 9 Left 1109134143 13:58625740-58625762 CCTGTGTGCAGTCTGGGGGTCTA No data
Right 1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG No data
1109134137_1109134147 18 Left 1109134137 13:58625731-58625753 CCACTGCCACCTGTGTGCAGTCT No data
Right 1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109134147 Original CRISPR CCTTCTGCCCTGCTGCTGAC AGG Intergenic
No off target data available for this crispr