ID: 1109140188

View in Genome Browser
Species Human (GRCh38)
Location 13:58704853-58704875
Sequence TTTCAGGTGCAGGATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109140176_1109140188 27 Left 1109140176 13:58704803-58704825 CCTGTGGTCCTACCTACTTGGGA 0: 8
1: 506
2: 8736
3: 64872
4: 182696
Right 1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG No data
1109140177_1109140188 19 Left 1109140177 13:58704811-58704833 CCTACCTACTTGGGAAGCTGAGG 0: 89
1: 5987
2: 108881
3: 217932
4: 255830
Right 1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG No data
1109140179_1109140188 15 Left 1109140179 13:58704815-58704837 CCTACTTGGGAAGCTGAGGTAAA No data
Right 1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109140188 Original CRISPR TTTCAGGTGCAGGATGTGGA AGG Intergenic
No off target data available for this crispr