ID: 1109142025

View in Genome Browser
Species Human (GRCh38)
Location 13:58725306-58725328
Sequence AGCTGGTGGCAGGAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109142018_1109142025 6 Left 1109142018 13:58725277-58725299 CCTAGTGAATGGGCATAGAATGG No data
Right 1109142025 13:58725306-58725328 AGCTGGTGGCAGGAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109142025 Original CRISPR AGCTGGTGGCAGGAGTGTGG AGG Intergenic
No off target data available for this crispr