ID: 1109142556

View in Genome Browser
Species Human (GRCh38)
Location 13:58733435-58733457
Sequence CAGGGTCTCCAGTTTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1385
Summary {0: 3, 1: 30, 2: 187, 3: 387, 4: 778}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109142556_1109142563 26 Left 1109142556 13:58733435-58733457 CCATCTGCAAACTGGAGACCCTG 0: 3
1: 30
2: 187
3: 387
4: 778
Right 1109142563 13:58733484-58733506 AGTCCAAAGACCTCAGAGTCAGG No data
1109142556_1109142559 -6 Left 1109142556 13:58733435-58733457 CCATCTGCAAACTGGAGACCCTG 0: 3
1: 30
2: 187
3: 387
4: 778
Right 1109142559 13:58733452-58733474 ACCCTGGGATATCAGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109142556 Original CRISPR CAGGGTCTCCAGTTTGCAGA TGG (reversed) Intergenic
900334767 1:2157001-2157023 CTGGGCCTCCAGCCTGCAGATGG - Intronic
900465612 1:2823982-2824004 CGGGGTCTCGAGGCTGCAGATGG + Intergenic
900646808 1:3712800-3712822 CAGGGTCACCTGTCAGCAGAGGG + Intronic
900871314 1:5305635-5305657 CTGGGTTTCCAGCTTGCATATGG - Intergenic
900905643 1:5555252-5555274 CCTGTTCTCCAGCTTGCAGATGG - Intergenic
901348413 1:8568360-8568382 CCGCATCTCCAGCTTGCAGATGG + Intronic
901421354 1:9153369-9153391 CAGGGTCACCTGTTTGGAGGAGG - Intergenic
901445225 1:9304306-9304328 CTGGGTCTCCAGCTTGCAGATGG + Intronic
901771663 1:11533621-11533643 CTGGGGCTTCAGTCTGCAGAGGG - Intronic
902259965 1:15217555-15217577 CTGGGTCTGCAGCTTACAGATGG - Intronic
902302588 1:15512573-15512595 CCTGGTCTCCAACTTGCAGATGG + Intronic
902407452 1:16192452-16192474 CACCGTCCCCATTTTGCAGATGG + Intergenic
902510697 1:16965538-16965560 CAGGGTGGCCAGTTTGTAAAGGG + Intronic
903008958 1:20317228-20317250 CAGGGTCTCCACTTTCCATGTGG - Intronic
903414689 1:23174122-23174144 CTGGTTCTCCAGCTTGCAAAAGG - Intronic
903746396 1:25589731-25589753 CTGGCTGTCCAGTTTGCAAATGG + Intergenic
903757362 1:25671986-25672008 CTGCTTCTCCAGTTTACAGATGG - Intronic
904045364 1:27605090-27605112 CAGGTTCTCCAGTTAGCAAGTGG + Intergenic
904078658 1:27858369-27858391 CAGTGTCTGCATTTTACAGATGG + Intergenic
904323894 1:29714652-29714674 CTGGTTCTCCAGCTTGCACATGG + Intergenic
904651529 1:32009464-32009486 CAGGGTCTCCAGCTTGCAGAAGG + Intergenic
904712302 1:32439502-32439524 CTGTGTCTCCAGCTTACAGATGG + Intergenic
904812928 1:33175518-33175540 CACGCTCCCCATTTTGCAGATGG - Intronic
905467801 1:38168800-38168822 CTGGGTCTCCAGTTTGCAAATGG + Intergenic
906273737 1:44501021-44501043 CAAGGCCTCCAGGCTGCAGAAGG + Intronic
907256097 1:53180272-53180294 CCAGGTCTCCAGCTTGCAGATGG + Intergenic
907768543 1:57436675-57436697 CAATGTCTCCATTTTGTAGAGGG - Intronic
907854806 1:58292190-58292212 CTGGGTCTCCAGCTTGCAGATGG + Intronic
907882239 1:58561354-58561376 CTGGGCCTCCAACTTGCAGATGG + Intergenic
907954842 1:59218269-59218291 CAGAGTCTCCAGCTTACAGATGG - Intergenic
908046602 1:60177116-60177138 CTGGGTCTCTAGCTTGCAGATGG - Intergenic
908698175 1:66868679-66868701 CTGTGTCCCCAGTTTGCACATGG + Intronic
908906211 1:69013572-69013594 CTGAGTCTCTAATTTGCAGATGG + Intergenic
908919466 1:69171672-69171694 CTGGGCCTCCAGCTTGCAGATGG + Intergenic
908956895 1:69642934-69642956 CTGGCTCTCCAGCCTGCAGATGG - Intronic
909289232 1:73861256-73861278 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
909302733 1:74033866-74033888 CAGGGTGTCCATTTTGAAGTAGG - Intronic
909713334 1:78677361-78677383 TATAGTCTCCAGGTTGCAGATGG - Intergenic
909834929 1:80242002-80242024 CTGGTTCTCCAGCTTGTAGATGG + Intergenic
910118454 1:83758133-83758155 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
910300386 1:85700284-85700306 CATGAGCTCCATTTTGCAGACGG + Intronic
910320952 1:85943298-85943320 CAGGGTCTCCAGTTTGCAGATGG + Intronic
910393614 1:86769725-86769747 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
910723065 1:90309140-90309162 AGGGGTTTCCAGCTTGCAGATGG - Intergenic
911380392 1:97106735-97106757 CTTGTTCTCCAGCTTGCAGATGG + Intronic
911456251 1:98127868-98127890 CAGGGGCCTCAGATTGCAGAAGG + Intergenic
911565800 1:99462041-99462063 GTGGGTCTCCAGCTTGCAGGTGG - Intergenic
912722745 1:112033865-112033887 CTGGGTGTCCAGCCTGCAGATGG - Intergenic
912749635 1:112275600-112275622 CAGGGTCTTCAATTTACACATGG + Intergenic
914461007 1:147885131-147885153 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
914906462 1:151749970-151749992 CTGGGGCTCTAGTTTGCAGATGG - Intergenic
916370551 1:164089498-164089520 CTGGGTCTCCAGCTTACAGATGG + Intergenic
916434305 1:164762563-164762585 CTGGGTCTGCAGTGTGCAGTAGG + Intronic
916459139 1:165004616-165004638 CCAGGTCTCCAGCTTTCAGATGG - Intergenic
916635327 1:166662006-166662028 CAGGGTCTCCATCTTGCAGATGG + Intergenic
916639328 1:166710132-166710154 CAAGGTCTCTAGCTTACAGATGG - Intergenic
916963376 1:169911198-169911220 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
917680303 1:177359032-177359054 CTGGGTCGCCAGCTTGCAGATGG - Intergenic
918358354 1:183728301-183728323 CTGTGTTTCCAGCTTGCAGATGG + Intronic
918533396 1:185548238-185548260 AAGGGTCTCCAGCTTGCAGATGG - Intergenic
918673762 1:187255770-187255792 CTGGGTCCTCAGCTTGCAGAGGG + Intergenic
918845734 1:189609045-189609067 CTGGGTCTCCAGTTTGCAGCTGG - Intergenic
919019601 1:192087561-192087583 CTGGTTCTTCAGCTTGCAGATGG - Intergenic
919067063 1:192705791-192705813 CTGAGTCTCCAGTTTGCAGATGG + Intergenic
919181945 1:194096782-194096804 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
919202793 1:194379297-194379319 CTGGGACCCCAGCTTGCAGATGG - Intergenic
919310073 1:195895913-195895935 CAGGATCTTCAGCTTACAGATGG - Intergenic
919411964 1:197257013-197257035 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
919426286 1:197435518-197435540 CAGAGTCACCAGTGTGCAAATGG + Exonic
920117350 1:203629979-203630001 CAGGCTTTCCATTGTGCAGAGGG - Intronic
920616404 1:207496555-207496577 GAGGGTCTCCAGTGCGCAGAAGG - Intronic
920632910 1:207669732-207669754 GAGGGTCTCCAGTGCGCAGAAGG - Intronic
920877928 1:209854678-209854700 TAGGGTCTCAAGATTACAGAAGG + Exonic
921467472 1:215506451-215506473 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
921512892 1:216053978-216054000 CAGGGTTTCCACTTAACAGAGGG + Intronic
921620118 1:217315886-217315908 CAGTGTCACCAGCTTGCAGCAGG + Intergenic
922039607 1:221883833-221883855 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
922093000 1:222415334-222415356 AATGGTCTCTGGTTTGCAGATGG + Intergenic
922204078 1:223431347-223431369 CTGGGCCTTCAGTTTGCAAATGG + Intergenic
922324972 1:224519420-224519442 CTGAGTCTCCAGCTTGCAGACGG + Intronic
922528494 1:226325084-226325106 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
922548151 1:226473920-226473942 CTGATTCTCCAGCTTGCAGATGG - Intergenic
922549083 1:226480770-226480792 CAGGGTCTCCAGCTTGCGGATGG + Intergenic
922671348 1:227510526-227510548 CAAAGACTCCAGTGTGCAGAAGG - Intergenic
923094580 1:230764463-230764485 CTGGTTCTCCAGTTTGCAAATGG + Intronic
923384125 1:233449623-233449645 CACGGTTTCCTGTTTGCACATGG - Intergenic
923791665 1:237116634-237116656 CTGGGTCTCCAGCTTGCAGATGG - Intronic
923906828 1:238394354-238394376 CTGGGTCTCCAGTTTGCAGAAGG - Intergenic
924153290 1:241150784-241150806 CTGGTTCTCCAGTTTGCAGAAGG - Intronic
924294595 1:242572505-242572527 CAGGGTCTCCAGCTTGCCAATGG + Intergenic
924396202 1:243623751-243623773 CAAGGTCTCCAGCTTCCAGATGG + Intronic
924418621 1:243885854-243885876 CTGGGCTTCCAGCTTGCAGATGG + Intergenic
924478066 1:244398891-244398913 CTGGGCCTCCAGTTTGCAGATGG - Intergenic
1062949512 10:1487455-1487477 CAGGGTCTCCACTCAGCAGCAGG - Intronic
1063011257 10:2023885-2023907 CTGGGCCTCCGGCTTGCAGAAGG - Intergenic
1063678237 10:8161078-8161100 CAGTGTTTCCAGTTTCAAGATGG + Intergenic
1063717897 10:8546700-8546722 CTGGGTCTCCAACTTGCAGATGG - Intergenic
1063827212 10:9911242-9911264 CAGGGTCTCCAGCTTGTGGATGG + Intergenic
1064009291 10:11722494-11722516 CCGGGTCTCCAGCTCACAGATGG + Intergenic
1064017055 10:11780945-11780967 CTGGGTCTCTAGTTTGCGGACGG - Intergenic
1064114121 10:12563086-12563108 CCGGGTCTCCAGTTTGCAGATGG - Intronic
1064236715 10:13582709-13582731 CAGGTTCTTCAGCTTGCAGAAGG + Intergenic
1064331096 10:14394907-14394929 CCGGGTCTTCAGTTTGAAGACGG + Intronic
1064453527 10:15465560-15465582 CTGGTTCTCCAGTTTGCAGGTGG + Intergenic
1064475945 10:15689650-15689672 CAGTGGCTCCTGTTTCCAGATGG - Intronic
1064493356 10:15883579-15883601 CTGGATCTCCAGCTTGCAGGTGG - Intergenic
1064638610 10:17393253-17393275 CTGGGGCTCCAGCTTGGAGAAGG + Intronic
1064648505 10:17484642-17484664 CTGGGTCTCCAGCTTGCAGAAGG - Intergenic
1064692462 10:17931932-17931954 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1064843428 10:19623495-19623517 CTGGTTCTTCAATTTGCAGATGG - Intronic
1065259203 10:23907444-23907466 CTGGTTCTCCAGCATGCAGATGG - Intronic
1065347207 10:24759983-24760005 CTGGGTCTCCAGCTTGCTGACGG + Intergenic
1065407908 10:25389318-25389340 CAGGGTCTCCTCTTTGCTGAGGG + Intronic
1065432798 10:25676483-25676505 CTGGATCTCCAGCTTGCAGACGG - Intergenic
1065679056 10:28210162-28210184 CTGGTTCTCCACGTTGCAGATGG + Intronic
1065867363 10:29925682-29925704 CTGGGTCTCCAGCTTGCAGAAGG + Intergenic
1065875154 10:29991495-29991517 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1067555983 10:47271933-47271955 CTGGGTGTCCAGCTTGCAGATGG + Intergenic
1067665916 10:48279123-48279145 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1067823806 10:49554798-49554820 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1068611985 10:59070252-59070274 CTGGCTCTCCAGTTTGCAAAGGG - Intergenic
1068761126 10:60710746-60710768 CTGGGTCTCCAGCTTGCTGATGG - Intronic
1068812783 10:61275397-61275419 CTGTGTCTCCAGCTTGCAGAAGG - Intergenic
1069045494 10:63738753-63738775 TATGGTCTGCAGCTTGCAGATGG + Intergenic
1069055917 10:63844564-63844586 CTGGTACTCCAGCTTGCAGATGG + Intergenic
1069066975 10:63952073-63952095 CTGGTTCTCCGGCTTGCAGATGG - Intergenic
1069194401 10:65531200-65531222 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
1069255612 10:66328717-66328739 GTGGGTCTCCAGCCTGCAGAAGG - Intronic
1069372026 10:67758189-67758211 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1069519575 10:69108006-69108028 TTGGTTCTCCAGCTTGCAGATGG - Intergenic
1069575137 10:69521805-69521827 CTGGTTCTTCAGCTTGCAGATGG + Intergenic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1070502793 10:77087235-77087257 CTGGGTCTCCAGCTTGCTGGTGG + Intronic
1070997671 10:80800198-80800220 CTGGGTCCCCAGTTTGCAGATGG + Intergenic
1071026477 10:81120237-81120259 AAGGGTTTCCAATTTGCAAATGG - Intergenic
1071191341 10:83105006-83105028 CTGGGGCTCCAGCTTGCAGATGG - Intergenic
1071343601 10:84670562-84670584 ATGGTTCTCCAGCTTGCAGATGG - Intergenic
1071898707 10:90094536-90094558 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
1071913998 10:90269856-90269878 CAGGTTCTCCTATTTACAGATGG + Intergenic
1072171314 10:92864840-92864862 CTGGTTCTCCAGCTTGCAGACGG + Intronic
1072277786 10:93839826-93839848 CAGGGTCTACAGCTTGCAGATGG - Intergenic
1073747446 10:106485837-106485859 CTGGGCCTCCAGCTTACAGATGG - Intergenic
1074219737 10:111424773-111424795 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1074632129 10:115270530-115270552 CTGGGTCTTCAGTTTGCAGACGG - Intronic
1074818227 10:117160319-117160341 CAGAAGCTCCAGTTGGCAGAAGG - Intergenic
1075128534 10:119720596-119720618 CTGGTTCTCCAGCTTGCAGAAGG - Intergenic
1075133981 10:119765997-119766019 CTGGTTCTCCAGATTGCAGATGG - Intronic
1075134362 10:119769833-119769855 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1075158478 10:120001693-120001715 CGGGTTCTCCAGCTTGCAGACGG - Intergenic
1075201096 10:120404882-120404904 CTGGTTCTCCAGCTTGCAGAAGG + Intergenic
1075270705 10:121047715-121047737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1075527194 10:123196924-123196946 CAGGGGCTGCTGTGTGCAGATGG + Intergenic
1075535844 10:123271495-123271517 CTGGGTCTCCAACTTGCAGATGG + Intergenic
1075593727 10:123712045-123712067 ATGGGTCTCCAGCTTGCAGATGG - Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1075681429 10:124335630-124335652 CTGGCTCCTCAGTTTGCAGATGG - Intergenic
1076122734 10:127949182-127949204 CAGGGTCTTCAGCTTGAAGATGG + Intronic
1076123639 10:127956338-127956360 CAGGGACTCCACCTTGCAAACGG + Intronic
1076534532 10:131168305-131168327 GAGGGGCCCCAGTTTGCAGTGGG - Intronic
1076563365 10:131381788-131381810 TGGGGTCACCAGTGTGCAGACGG - Intergenic
1076620483 10:131784295-131784317 CTGGGTCTCCAGCTTGCAAATGG - Intergenic
1077399287 11:2345790-2345812 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1077400549 11:2354304-2354326 CCTGGTCCCCAGCTTGCAGATGG + Intergenic
1077932445 11:6748197-6748219 CATGGTTTCCAGTTTGCTCATGG - Intergenic
1078318575 11:10312353-10312375 CTGGTTCTCCAGTTTGCAGACGG + Intronic
1078486817 11:11730945-11730967 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1078744141 11:14095513-14095535 CTGGGTCTCCGGTTTGCAGATGG - Intronic
1079203064 11:18391900-18391922 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1079241964 11:18727807-18727829 AAGGGGCTCCAGTGAGCAGAAGG + Intergenic
1079448577 11:20579695-20579717 CTGGGCCTCCAACTTGCAGATGG - Intergenic
1079861957 11:25684077-25684099 CTGGCCCTCCAGCTTGCAGATGG + Intergenic
1080163277 11:29205017-29205039 CTGGTTCTCTAGCTTGCAGATGG + Intergenic
1080248051 11:30201640-30201662 CAGGTTCTCCAGCTTACAGATGG + Intergenic
1080335686 11:31193147-31193169 CTGGTTCTCTAGTTTGCAGATGG + Intronic
1080429881 11:32188641-32188663 CAGGGGCTCCATGTTGGAGAGGG - Intergenic
1081000214 11:37660350-37660372 CTGGGTTTCCAGGTTGCATATGG - Intergenic
1081243784 11:40738308-40738330 CAGGGTCTTCAGTTTGCAGATGG + Intronic
1081539777 11:44024317-44024339 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1081741368 11:45443307-45443329 CAGGGTCTGGAGAATGCAGAGGG + Intergenic
1082266680 11:50126690-50126712 CTGGGTCTCCAGTTTTCAGGTGG + Intergenic
1082289409 11:50351878-50351900 CTGGGTCTCCAGTTTTCAGGTGG - Intergenic
1083270559 11:61570085-61570107 CAGCCTCTCCACTTTTCAGAGGG + Intronic
1083387551 11:62322835-62322857 CTGGTTCTCCAGCTTGCAGCTGG + Intergenic
1083492485 11:63023132-63023154 CATTGTCCCCATTTTGCAGATGG - Intergenic
1083611547 11:64006811-64006833 TAGCGTCTCCATTTTGCAGGTGG - Intronic
1083704290 11:64503281-64503303 CTGCTTCTCCTGTTTGCAGATGG - Intergenic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1084469734 11:69352064-69352086 CTGGGTCTCCAGCTTGCAGAGGG - Intronic
1085251709 11:75148238-75148260 CAGGATCTCCATTTAACAGATGG + Intronic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085339442 11:75721777-75721799 CAAGGTCTCCAGCTTGCAAAGGG + Intronic
1085758376 11:79220321-79220343 CAAGGGTTCCAGTTTGCTGAGGG + Intronic
1086056193 11:82649902-82649924 CTGGTTCTCCAACTTGCAGATGG + Intergenic
1086490094 11:87350326-87350348 TAGGGTCTCCAGCTTGCAGACGG + Intergenic
1087575170 11:99981188-99981210 CAGGGTCTTTAGCTTGCAGATGG - Intronic
1087587660 11:100142212-100142234 CTGGGTCACCAGCTTGCAGATGG + Intronic
1087618125 11:100511808-100511830 CTGGGTCTCCAGGCTGCAGACGG + Intergenic
1087624312 11:100579662-100579684 CTGGTTCTGCAGCTTGCAGATGG - Intergenic
1087886364 11:103487640-103487662 CTGGTTCTCCAACTTGCAGATGG + Intergenic
1087982425 11:104632349-104632371 CAGGTTATTCAGCTTGCAGATGG + Intergenic
1088851447 11:113706499-113706521 CTGAGTTTCCAGTTAGCAGATGG - Intergenic
1088923117 11:114276141-114276163 CAGGGTCCCAAGTTGGCACAAGG - Intronic
1089156694 11:116408125-116408147 CCAGGTCACCAGCTTGCAGAAGG + Intergenic
1089164478 11:116464510-116464532 TTGGTTCTCCAGCTTGCAGATGG + Intergenic
1089238242 11:117051335-117051357 CTGGTTCTCCAGGTTGCACATGG + Intronic
1089649459 11:119903142-119903164 CAGAGTCTCCAGCTTGCAGATGG - Intergenic
1090464432 11:126921296-126921318 CTGGGTCTCCACCTTGCAGAAGG + Intronic
1090577763 11:128126245-128126267 CAGGGACTCCAGCTTGAAGGAGG + Intergenic
1091662622 12:2395935-2395957 TAGGGTCCCCAGTGTTCAGAGGG + Intronic
1091859438 12:3766712-3766734 CTGGGTCTCCAGCTTGCTGATGG - Intergenic
1092643574 12:10543814-10543836 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1092742344 12:11641908-11641930 CTGGTTCCCCAGCTTGCAGATGG + Intergenic
1092746642 12:11678705-11678727 CTGGGTCTCCAACTTGCAGATGG - Intronic
1092813993 12:12297159-12297181 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1092937360 12:13376547-13376569 CTGGGCCTCCAGCTTGCAGATGG - Exonic
1092956110 12:13551800-13551822 CCAGGTCTCTGGTTTGCAGAGGG + Exonic
1093004170 12:14034146-14034168 TTGGTTCTCCAGCTTGCAGATGG + Intergenic
1093010181 12:14099336-14099358 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1093160347 12:15739679-15739701 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1093828950 12:23731271-23731293 CAGGGTCTCCAGCTTGCAGAAGG + Intronic
1094132311 12:27087396-27087418 CTGGGTCTCCAGCTTGCAGTTGG + Intergenic
1094266792 12:28568738-28568760 CAGGGTCTCCATTTTTAAGGAGG - Intronic
1094304922 12:29008038-29008060 CTGGGTCTCTAGCTTGCTGATGG + Intergenic
1094399631 12:30047992-30048014 CTGGTTCTCCAGCTTGCAAATGG + Intergenic
1094617607 12:32049819-32049841 CAAGGTCTCCAGCTCGCAGATGG + Intergenic
1094661092 12:32471247-32471269 CTGGGCCTCCAGCTTGCAGATGG + Intronic
1094684598 12:32698569-32698591 CAGGGTCTGCAGGAAGCAGATGG - Intronic
1094731795 12:33185057-33185079 AAGGGTCTCCAATTTGGAGCTGG - Intergenic
1095138751 12:38637701-38637723 CAGGGCCCCAAGTTTGCAAATGG + Intergenic
1095188085 12:39224991-39225013 CAGTGGCTCCAGTTTCAAGATGG + Intergenic
1095385488 12:41645091-41645113 TTGAGTCTCCAGCTTGCAGATGG + Intergenic
1095424395 12:42060002-42060024 CAGGTTCTCCAGCTTGCAGAGGG + Intergenic
1095683715 12:45008092-45008114 CTGGTTCTCCATCTTGCAGATGG + Intergenic
1095873026 12:47051156-47051178 CAGTGTCTCGAGGTTGCACAGGG + Intergenic
1096345098 12:50839237-50839259 CTGTTTCTCCAGCTTGCAGATGG + Intergenic
1096468499 12:51862076-51862098 CAGGGTCTCCATTTCACAGATGG - Intergenic
1097377581 12:58858338-58858360 CAGGGCCTCAAGTTTGTAAATGG - Intergenic
1097533535 12:60836727-60836749 CTGGGGCTCCAGTTTGCTGATGG - Intergenic
1097750747 12:63349489-63349511 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1097985291 12:65776495-65776517 CAGGGTCTCCTGTCTTCACATGG - Intergenic
1098031163 12:66256452-66256474 CTGGCTCTTCAGTGTGCAGACGG - Intergenic
1098158697 12:67626324-67626346 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1098194578 12:67986137-67986159 CTGGGCCTTCAGCTTGCAGATGG + Intergenic
1098231459 12:68375694-68375716 CAGGATCTCCAGCTTGAAGGGGG - Intergenic
1098670606 12:73225668-73225690 CAGGGCCTCTAGCTTACAGATGG - Intergenic
1098746241 12:74240721-74240743 CTGGTTCTCCGGCTTGCAGATGG + Intergenic
1098763881 12:74460172-74460194 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1099028634 12:77496784-77496806 CAGGGTCTTCATTTTGCACTGGG - Intergenic
1099324938 12:81202999-81203021 CAGGGTCTCAAACTTGCAGATGG - Intronic
1099580195 12:84436255-84436277 CTGGTTCTCCAGCTTGCAGAAGG - Intergenic
1099597181 12:84681908-84681930 CTGGGTCTCCAAATTGTAGATGG + Intergenic
1099757013 12:86864669-86864691 CATTTTCTCCAGTTTGAAGATGG - Intergenic
1099868922 12:88321426-88321448 CTGGCTCTTCAGCTTGCAGATGG + Intergenic
1099879743 12:88454104-88454126 GTGGATCTCCAGCTTGCAGAGGG - Intergenic
1100097246 12:91055778-91055800 CAGGTTCTCCAGATTGCTAAAGG + Exonic
1100213394 12:92421780-92421802 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1100223159 12:92528502-92528524 CTGGGTCTCCAGGTTGTAGATGG + Intergenic
1100285929 12:93166346-93166368 CAGAGTCTGCATTTTGCTGATGG - Intergenic
1100800313 12:98223931-98223953 CTGGGTCTCTAGTTTACAGATGG - Intergenic
1101036511 12:100712953-100712975 CTGGGTCTTCAGCTTGCAGATGG - Intergenic
1101375754 12:104169976-104169998 CTGTTTCTCCAGCTTGCAGATGG - Intergenic
1101396427 12:104352362-104352384 CTGGGCCTCCAGCCTGCAGATGG + Intergenic
1101550850 12:105760308-105760330 CTGGGTCTCCAGCTTACAGATGG - Intergenic
1101837161 12:108303722-108303744 CAGGGTGTGCATTTTACAGACGG + Intronic
1101849077 12:108387949-108387971 CTGGGTTTCCAACTTGCAGATGG - Intergenic
1101870207 12:108559790-108559812 CTGGCTCTCCAGCTTCCAGATGG + Intronic
1101894946 12:108749351-108749373 CTGAGTCTCCAGTTTGCAGATGG - Intergenic
1101932409 12:109025214-109025236 CAGGGTTTCTAGCTTGCAAATGG + Intronic
1102233273 12:111278089-111278111 CAGGGACTGAAGGTTGCAGATGG - Intronic
1102442398 12:112973705-112973727 CTGAGTCTCCAGCTTGCAGACGG - Intergenic
1102863692 12:116357652-116357674 CTGGGTCTTCAGCTTGCAGATGG - Intergenic
1102949859 12:117024207-117024229 CAGGGTCTCTGCTGTGCAGATGG + Exonic
1103130568 12:118464943-118464965 TGGGGTCTCTAGTTTGCAGATGG + Intergenic
1103576487 12:121881358-121881380 CAGGGTCTCAGGTTGGCTGAAGG - Intergenic
1103705625 12:122870283-122870305 CAGGGTCTGCAGTGTGAAGCAGG - Intronic
1103838977 12:123847427-123847449 CTGGTCCTCCAGCTTGCAGATGG - Intronic
1104181677 12:126387799-126387821 TTGGGTCTCCAGCTTGCAGAGGG - Intergenic
1104374360 12:128250717-128250739 CTTGGTCCCCAGCTTGCAGAGGG + Intergenic
1104531761 12:129578631-129578653 CTGGGTCACCAGCTTGCAGATGG - Intronic
1104927102 12:132319495-132319517 CCGGGCCTGCAGCTTGCAGACGG + Intronic
1105563835 13:21523186-21523208 CTGGGTCTACAGCTTGCAGATGG + Intronic
1105700373 13:22931413-22931435 CTGGGTCTCTAGCTGGCAGATGG - Intergenic
1105752749 13:23436537-23436559 CTTGTTCTCCAGCTTGCAGATGG + Intergenic
1105754750 13:23454020-23454042 CCTGGTCTCCAGCTTGCAGATGG - Intergenic
1105783401 13:23724132-23724154 CCAGGTCTTCAGCTTGCAGATGG - Intergenic
1105838506 13:24232112-24232134 CTGGTTCTCCAGGCTGCAGATGG - Intronic
1105853139 13:24353456-24353478 CTGGGTCTCCAGCTGGCAGATGG - Intergenic
1106076698 13:26466540-26466562 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1106101831 13:26700324-26700346 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1106143802 13:27034544-27034566 CTGGGTCTCCAGCTTCCTGATGG - Intergenic
1106160779 13:27199510-27199532 CAGGGTGTCCAGCTTGCACATGG + Intergenic
1106546342 13:30734010-30734032 CTGAGTCTCCAGCTTGCAGATGG + Intronic
1107292189 13:38867612-38867634 CTGGTTCTCCATCTTGCAGATGG - Intronic
1107332980 13:39321292-39321314 CAAGGTCTTCAGCTTGCACAGGG + Intergenic
1107420233 13:40239431-40239453 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1107586774 13:41858098-41858120 CTGGCTCTCCAGCTTGCAGATGG + Intronic
1107676805 13:42806167-42806189 CAGAGTCTCCAGCTTGCAGATGG + Intergenic
1107807097 13:44163532-44163554 TTGGGTCTCCAGCTTGCAGGTGG + Intergenic
1107966515 13:45602978-45603000 CTGATTCTCCAGCTTGCAGATGG - Intronic
1107994198 13:45844548-45844570 CAGGGTCTCTAGCTTGCAGATGG + Intronic
1108149048 13:47512489-47512511 CTTGCTCTCCAGCTTGCAGACGG + Intergenic
1108264104 13:48687246-48687268 CAGGGTCTCTATCTTGCCGACGG + Intronic
1108293906 13:48992559-48992581 CAAAGTCTCCAGTTTACAAATGG + Intronic
1108437627 13:50416558-50416580 CAGGTTCTTCACTTTCCAGAGGG - Intronic
1108549152 13:51525922-51525944 TTGGTTCTCCAGCTTGCAGATGG - Intergenic
1108718530 13:53106101-53106123 CTGGTTCTCCAGCTTTCAGATGG + Intergenic
1108753975 13:53477693-53477715 CAGGGACACCAGCTTGCAGATGG - Intergenic
1108754895 13:53487708-53487730 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1109142556 13:58733435-58733457 CAGGGTCTCCAGTTTGCAGATGG - Intergenic
1109153282 13:58871637-58871659 CTGGGTCTCCAGTTTGCAGATGG + Intergenic
1109273888 13:60283220-60283242 CTGGACCTCCAGCTTGCAGATGG - Intergenic
1109345289 13:61108713-61108735 CAGAGTCTCCAGCTTACAGCTGG + Intergenic
1109933000 13:69242217-69242239 CTGGTTTTCCAATTTGCAGATGG - Intergenic
1109965414 13:69686748-69686770 CTGGCTCTCCAGATTGAAGATGG - Intergenic
1110065369 13:71098406-71098428 CTGGTTCTCCAGCTTGTAGATGG - Intergenic
1110187286 13:72690359-72690381 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1110246933 13:73336705-73336727 CAGGATCTCTAGTTTGCAGCAGG - Intergenic
1110397006 13:75041982-75042004 CTGGGTCTCCAGCTTGCAAATGG + Intergenic
1110541799 13:76714135-76714157 CTGGTTCTCCAGCTTGCAGAGGG + Intergenic
1110664192 13:78096581-78096603 CTGGTTCTCCGATTTGCAGATGG + Intergenic
1110889643 13:80682328-80682350 CTGAGTCTCCTGGTTGCAGAAGG + Intergenic
1111529212 13:89515108-89515130 CTGGTTCTCCAGCTGGCAGAAGG - Intergenic
1111679528 13:91426480-91426502 CTGGCTCCTCAGTTTGCAGATGG - Intronic
1111887229 13:94037604-94037626 TATGATCTCCATTTTGCAGATGG + Intronic
1112239391 13:97666253-97666275 CTGGGTCTTCAGCTTGCAGGTGG - Intergenic
1112403714 13:99099304-99099326 CTGGGTCTCCAGCTTACAGATGG - Intergenic
1112614172 13:100986180-100986202 CTGGTTCCCCAGGTTGCAGATGG + Intergenic
1112802662 13:103129726-103129748 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1112988385 13:105480627-105480649 CAGGATCTCCAGCTTGCAGATGG - Intronic
1113302628 13:109038533-109038555 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1114363607 14:22003320-22003342 CATGGTCTCCAGTTTGGAAGGGG - Intergenic
1114699507 14:24663045-24663067 GAGGATCTCCAGTCTGCAGCAGG - Intergenic
1116105339 14:40495443-40495465 CTGGTTCTCTAGCTTGCAGAAGG + Intergenic
1116578271 14:46604479-46604501 GTGGTTCTCCAGTTTGCAGATGG - Intergenic
1116807870 14:49511190-49511212 CTGGGCCTCCAGCTTGCAGATGG - Intergenic
1116853742 14:49933596-49933618 CTGGGCCTTCAGCTTGCAGACGG - Intergenic
1116861292 14:49997669-49997691 CTGGGTCTCCAGCTTGTAGATGG + Intronic
1117090370 14:52244125-52244147 CAGGGGCTCCCCTTTGCACATGG - Intergenic
1117458596 14:55922313-55922335 CTGGGCCTCCAGCTTGCAGATGG - Intergenic
1117500110 14:56343216-56343238 CAGTCTCTCCATTTTACAGATGG + Intergenic
1117779767 14:59220605-59220627 CTAGTTCTCCAGCTTGCAGATGG - Intronic
1117906035 14:60588441-60588463 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1118130998 14:62963458-62963480 TTGGGTCTCCTGGTTGCAGATGG - Intronic
1118373768 14:65159276-65159298 CTGATTCTCCAGCTTGCAGATGG + Intergenic
1118427310 14:65680137-65680159 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1118934063 14:70269876-70269898 CAAGGTCTCCAGCTTGCAGATGG + Intergenic
1119118007 14:72045061-72045083 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1119211485 14:72835558-72835580 CAGTTTCTCCAGCTTGCAGCAGG + Intronic
1119339800 14:73867284-73867306 CTGAGTCTTCAGCTTGCAGATGG + Intronic
1119571307 14:75675917-75675939 CAGGGTCTCCAACTTGCAAATGG - Intronic
1119640290 14:76309774-76309796 GTGGGTCTCCAGATGGCAGATGG + Intergenic
1119907241 14:78317054-78317076 CTTCCTCTCCAGTTTGCAGACGG - Intronic
1120250429 14:82056847-82056869 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1120362137 14:83518153-83518175 CATAATCTCCAGCTTGCAGAAGG + Intergenic
1120362146 14:83518435-83518457 CAGGGTCTCCAGCTTGCAGAAGG - Intergenic
1120394186 14:83946518-83946540 CTGGGTCTTCAGGTTGTAGATGG + Intergenic
1120484367 14:85092441-85092463 CTGGGTCTTCAGCTTGCAGATGG + Intergenic
1120488667 14:85148345-85148367 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1120712104 14:87803842-87803864 CTAGGTCTCCAGCTTGGAGAGGG - Intergenic
1120717013 14:87851100-87851122 CTGGGTCTCCAGCTACCAGATGG - Intronic
1120811649 14:88809334-88809356 CTGGGCCTCCAGCTTGCAGATGG + Intergenic
1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG + Intronic
1121486182 14:94316990-94317012 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1121643638 14:95502647-95502669 CACCATCTCCATTTTGCAGAAGG + Intergenic
1121705340 14:95988972-95988994 CTCGGTCTCCAGCTTGCAGATGG + Intergenic
1121710442 14:96034758-96034780 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1121835711 14:97090273-97090295 CTGGGTCTTCAGTTTGCAGGTGG - Intergenic
1122116456 14:99529958-99529980 TAGTGTCCCCATTTTGCAGAGGG + Intronic
1122181166 14:99955816-99955838 CTGGGCCACCAGTTTGCAGATGG + Intergenic
1122190952 14:100043395-100043417 CTGGGTCTCCAGCGTGCAGACGG - Intronic
1122349316 14:101078288-101078310 CTGGGCCTCCAGTTTCCAGGTGG + Intergenic
1122841901 14:104469379-104469401 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1202899263 14_GL000194v1_random:26228-26250 CAGGGTCTCCAGCGTCCACAGGG + Intergenic
1123777929 15:23598963-23598985 CTGGATTTCCAGCTTGCAGAAGG - Intronic
1123827032 15:24092563-24092585 CAGTGGCTCCAGGTTGCACAGGG + Intergenic
1124026855 15:25974786-25974808 CTGAGTCTCCAGTTTGCAGATGG + Intergenic
1124356566 15:28999838-28999860 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1124356808 15:29001538-29001560 ATGAGTCTCCACTTTGCAGATGG - Intronic
1124384292 15:29193568-29193590 CAGGGTCTCCAGCTTGCAGATGG + Intronic
1124401725 15:29354310-29354332 CAGGGTCTCCAGCCTGGAGATGG + Intronic
1124610376 15:31203921-31203943 CAGGGTCTCCAGCATGTCGATGG - Intergenic
1126901369 15:53318139-53318161 CTGGCCCTCCAGCTTGCAGATGG - Intergenic
1127365173 15:58282931-58282953 CTGGGCCTCAAGCTTGCAGACGG - Intronic
1128020471 15:64385951-64385973 CAGGGTCTCCTGCTTGCAGATGG + Intronic
1128212489 15:65912354-65912376 CAGGCTCTCCAGATTTCAGTAGG - Intronic
1128370103 15:67034065-67034087 CAGGGTCCCCAGCCTGCCGATGG - Intergenic
1128492453 15:68162577-68162599 CTGGTTCTCCAGCTTGCTGATGG - Intronic
1128713040 15:69886204-69886226 AAGGGTCTCTCGGTTGCAGATGG + Intergenic
1129255719 15:74332950-74332972 CAGGGTCTCCAGTCTGCCTGGGG + Intronic
1129281364 15:74487772-74487794 CAGGGTCTCCAGCTTGCATATGG - Intergenic
1129703553 15:77781888-77781910 CAGGGCTACCATTTTGCAGATGG - Intronic
1129738151 15:77977005-77977027 CAATGCCTCCACTTTGCAGACGG - Intergenic
1129847921 15:78776588-78776610 CAATGCCTCCACTTTGCAGATGG + Intronic
1129970030 15:79769967-79769989 CATGGTCTCCAGTGGGCAGCAGG - Intergenic
1130081998 15:80742212-80742234 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1130253992 15:82317328-82317350 CAATGCCTCCACTTTGCAGACGG - Intergenic
1130796859 15:87218762-87218784 CAGGGTCCCCAGTTTGAAATTGG + Intergenic
1130920618 15:88341100-88341122 CTGGTTCTCTAGCTTGCAGACGG + Intergenic
1131463287 15:92635018-92635040 CTGGGTCTCCAGCTTACAGATGG + Intronic
1132152395 15:99471724-99471746 CTGGGTCTTCAGCTTGCAGATGG + Intergenic
1132194621 15:99903590-99903612 CTGGTTCTCCTGCTTGCAGATGG + Intergenic
1132231961 15:100190976-100190998 CAGAGTCGACATTTTGCAGACGG - Intronic
1132609607 16:808775-808797 CCAGGTCTCCGGCTTGCAGATGG - Intronic
1133326710 16:4946307-4946329 GAGTGTCCCCATTTTGCAGATGG - Intronic
1133545239 16:6799898-6799920 CTTGCTCTTCAGTTTGCAGATGG + Intronic
1134192709 16:12134928-12134950 CTGGCTCTCCAGCCTGCAGAGGG - Intronic
1134419001 16:14069411-14069433 CTGGCTTTCCAGTTTGGAGATGG + Intergenic
1134978517 16:18589445-18589467 TAGGTTCTCCATTTTACAGAAGG - Intergenic
1135106785 16:19656592-19656614 CATCGTCTCCACTTTACAGATGG - Intronic
1135177982 16:20248032-20248054 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1135201491 16:20441527-20441549 CTGGGTCTCCAGCATGCAGATGG - Intergenic
1135217617 16:20586339-20586361 CTGGATCTCCAGCATGCAGATGG + Intergenic
1135253654 16:20922853-20922875 CTGGGTCTCCAGCTTGCAGACGG - Intronic
1135471892 16:22738468-22738490 CCAGGTCTCCAGCTTGCAGATGG + Intergenic
1135790844 16:25393919-25393941 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1135917171 16:26615577-26615599 CTGGGTCTCCAGCTTCCAGATGG + Intergenic
1135930945 16:26736122-26736144 CTGGGTCTCCATCTTGCAGACGG + Intergenic
1136181508 16:28555635-28555657 CTGGGCTTCCAGCTTGCAGATGG - Intronic
1136543631 16:30943012-30943034 CAGGGTCTCCAGCTCCCTGAGGG + Intronic
1136560480 16:31036193-31036215 CAGGGACCCCAGATTGAAGATGG + Intronic
1137727085 16:50664206-50664228 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1137732131 16:50697014-50697036 CATGGTCTCCAGGATGCACAAGG + Intronic
1137870752 16:51947848-51947870 CACTGTCTCCACTTTGCAGGTGG + Intergenic
1138719381 16:59061149-59061171 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1138812305 16:60165529-60165551 CTGGGTCTCTAGTTTGCAGATGG - Intergenic
1138924897 16:61579764-61579786 CTGGTTCTCCAGTTTACAGATGG - Intergenic
1138973509 16:62174580-62174602 CTCGGTCTCCAGTTTGTAGATGG + Intergenic
1138976973 16:62219959-62219981 CTGGGTCTCCTGTTTGCAGATGG - Intergenic
1139044117 16:63035494-63035516 CTGGTTCTCCAGCTTGCAGAAGG + Intergenic
1139063259 16:63281660-63281682 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1139100816 16:63764243-63764265 CTTGTTCTCCAGCTTGCAGAGGG + Intergenic
1139217005 16:65135803-65135825 CTGGCTCCTCAGTTTGCAGACGG + Intergenic
1139345712 16:66302231-66302253 CAGTCTCTCCATCTTGCAGATGG - Intergenic
1139625795 16:68187644-68187666 CAGGGTCTCCTCTCTGCTGAGGG - Intronic
1139703934 16:68727301-68727323 CTGGTTCTCCAGCTTGTAGATGG + Intergenic
1139761225 16:69186269-69186291 CTGGGCCTGCAGTTTGCAGATGG + Intronic
1139824346 16:69745334-69745356 CACCGTCTCCATTTTACAGATGG + Intronic
1140231856 16:73123843-73123865 CTGGGTCTTCATATTGCAGAAGG - Intergenic
1140452892 16:75085905-75085927 CCAGGTCTCCAGCTTGCAGATGG - Intronic
1140665342 16:77222349-77222371 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1141267195 16:82507958-82507980 CAGGCTCTCCAGTTTCAGGAAGG - Intergenic
1141536236 16:84682294-84682316 CTGGCTCTCCAGCTTGCAGAGGG + Intergenic
1142375971 16:89707325-89707347 CAGGGTATGCTGTTTGCTGATGG - Exonic
1143501809 17:7343622-7343644 GGGGGTCTCCAGTGTGCAGTGGG + Intronic
1143532902 17:7516061-7516083 CTGGTTCTCCAGATTACAGATGG - Intergenic
1144025167 17:11271018-11271040 CAGGGTCTCTAGGGTGCAAATGG + Intronic
1144129042 17:12228417-12228439 CTGGTTCTCCAGCTTGCTGATGG - Intergenic
1144198387 17:12917285-12917307 CTGGTTCTCCAGCTTACAGATGG - Intronic
1144269851 17:13605255-13605277 CAGGGTCCGCAGCTTGCAAATGG - Intergenic
1144324180 17:14161825-14161847 TAGGGTCTCCAGCTTGCAGATGG + Intronic
1144391379 17:14796694-14796716 CATGGTCTGCACTTTGCTGAGGG + Intergenic
1146080190 17:29772944-29772966 CGGTGTCTCCAGCTTGCAGATGG + Intronic
1146559415 17:33855240-33855262 CAGGGTCTCCAGTCTGGAGTTGG - Intronic
1146603689 17:34239954-34239976 TTGGGCCTCCAGCTTGCAGATGG - Intergenic
1146646934 17:34581993-34582015 GAGCGTCTCCAGCTTGCGGAAGG - Intronic
1146667482 17:34714825-34714847 CAGGATCCCCATTTTACAGACGG + Intergenic
1146831499 17:36073219-36073241 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1147658043 17:42102094-42102116 CATGGCCTCCAGTCTGAAGAGGG - Intronic
1147701743 17:42400468-42400490 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1147901060 17:43785139-43785161 CAGGGTCTCCAGCTTGCAGATGG - Exonic
1148629439 17:49095469-49095491 CAGGGCCTCCAGCTTGCAGACGG + Intergenic
1149086553 17:52724378-52724400 TAGGGTCTCCAGCTTGTAGAAGG + Intergenic
1149399507 17:56280553-56280575 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1149426550 17:56560024-56560046 CTGGTTGTTCAGTTTGCAGATGG + Intergenic
1150557347 17:66266394-66266416 CTGGGTCTCCAGCTTGCAGTTGG - Intergenic
1150714944 17:67564267-67564289 CAGGGTCTCCAACTTGCAGGTGG - Intronic
1150834399 17:68551496-68551518 CTGGGTCTGCTGTTTGCAGCTGG + Intronic
1150948928 17:69779971-69779993 CTGGTTCTCCAATTTGCAGACGG - Intergenic
1151941798 17:77297139-77297161 CTGGGCCTCCAGCTTGCGGACGG - Intronic
1152103447 17:78315811-78315833 CCGGGGCTCCAGTTTCCAAAAGG + Intergenic
1152318952 17:79597295-79597317 CAGGGACTCCGGTTTGCATTGGG + Intergenic
1152371118 17:79889166-79889188 CTGGGTCTCCAGCTTGCAGGCGG + Intergenic
1152407303 17:80104987-80105009 CAGGTTCTCCAGCTTGTAGCTGG - Intergenic
1152642812 17:81456238-81456260 CAGGGGCTGTGGTTTGCAGAGGG + Intronic
1152861856 17:82701017-82701039 CAGGGCCCCCAGTTTCCTGAGGG + Intergenic
1153077555 18:1182270-1182292 CTGGTTCTCCATATTGCAGATGG + Intergenic
1153279331 18:3399286-3399308 CTGGGTCTCCAGCTTACAGATGG + Intergenic
1153432275 18:5030846-5030868 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1153452408 18:5244332-5244354 CTGATTCTCCAGCTTGCAGATGG - Intergenic
1153783330 18:8513370-8513392 CAGCTTCTCCTGTTTGCAGAAGG + Intergenic
1154268953 18:12902526-12902548 CTGGGTCTTGAGTTTTCAGATGG + Intronic
1154491878 18:14928648-14928670 CTGAGTCTCCAGATTGCAGATGG + Intergenic
1155146932 18:23092182-23092204 CCGGGTCTCCAGCTTCCAGATGG - Intergenic
1155220161 18:23677962-23677984 CTGGTTCTCCAGCTTGCAGGTGG - Intergenic
1155337101 18:24775877-24775899 CTGGGTCCCCTGTGTGCAGATGG - Intergenic
1155531416 18:26770799-26770821 CTGGATCTCCAACTTGCAGAAGG - Intergenic
1155563959 18:27111963-27111985 CTGGGTCTCCAGCTTACAGATGG + Intronic
1155563973 18:27112233-27112255 CTGGGTTTCCAGCTTGCAGATGG - Intronic
1155580495 18:27299735-27299757 CTGGGTCTCTAGCTTGCAGATGG + Intergenic
1155618278 18:27746333-27746355 CTGGTTCTGCAGCTTGCAGACGG + Intergenic
1155802340 18:30123332-30123354 CAGGATCTCTGGCTTGCAGATGG + Intergenic
1156118770 18:33818503-33818525 CTGGGTGTCCAGCTTGCAGAGGG + Intergenic
1156119207 18:33821225-33821247 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1156182583 18:34622857-34622879 CAAAGTCTCCAGCTTGCAGATGG + Intronic
1156329353 18:36104832-36104854 CAGGGTCTCCAGCTTGCAGACGG + Intergenic
1156657383 18:39305032-39305054 TTGGTTCTCCAGCTTGCAGATGG + Intergenic
1156659018 18:39323642-39323664 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1157055263 18:44220645-44220667 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1157176589 18:45457829-45457851 CATGATCTCCATTTTACAGATGG - Intronic
1157444421 18:47734029-47734051 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1157540694 18:48503626-48503648 CTGGCTCTCCAGCTTGCAGATGG - Intergenic
1157574209 18:48732816-48732838 CAGGGTCTCCAATTTGTGCAAGG + Intronic
1157687249 18:49652234-49652256 CAGGGTCTCCTGAATGGAGAGGG - Intergenic
1157690658 18:49679318-49679340 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1157970953 18:52268158-52268180 ATGGTTCTCCAGCTTGCAGATGG + Intergenic
1158006157 18:52674227-52674249 CTTGGTCTCCAGCTTGCAAATGG - Intronic
1158323169 18:56285430-56285452 CACGGTCTCCAGCTTGCAGACGG + Intergenic
1158655203 18:59324535-59324557 CTGGGTCTCCGGCTTGCAGATGG + Intergenic
1158758199 18:60351771-60351793 CAGGATCTCCAGCTTGCAGATGG - Intergenic
1158799712 18:60892103-60892125 CTGGTTCTCCAGCTTACAGATGG - Intergenic
1158821275 18:61162041-61162063 CTGGGTCTACAGCTTGCAAATGG - Intergenic
1159280329 18:66276677-66276699 CAGGTGCTTCAGCTTGCAGATGG - Intergenic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1159460676 18:68719332-68719354 CTGGTTCTCCAGCTTGCAGATGG - Intronic
1159545118 18:69831086-69831108 TTGGGTCTCCAGCTTGCAGATGG - Intronic
1159664016 18:71134689-71134711 CTGGTTCTCCTGCTTGCAGATGG + Intergenic
1159678801 18:71321009-71321031 TTGGGTCTCCAGCTTGCACAGGG - Intergenic
1159783285 18:72684302-72684324 CTAGGTCTCCAGCTTACAGACGG - Intergenic
1159876308 18:73815172-73815194 CTGGGCCTCCAACTTGCAGACGG - Intergenic
1159877764 18:73830786-73830808 AAGGGCCTCAAGTTTGCAGTTGG + Intergenic
1159912142 18:74155837-74155859 CTTTGTCTTCAGTTTGCAGAAGG + Intronic
1160020484 18:75176826-75176848 CTGGGTCTCCAGTCTGCAGACGG + Intergenic
1160044580 18:75375034-75375056 CTGGGTCTCTAGCTTGCAGATGG - Intergenic
1160203314 18:76812897-76812919 CTGGTTTTCCAGCTTGCAGACGG + Intronic
1160445304 18:78922846-78922868 CAGGGTCACCCGTCAGCAGAGGG + Intergenic
1160809658 19:1007927-1007949 CACGGTCAGCAGTTTGCAGTCGG - Exonic
1162408825 19:10492209-10492231 GAGGGTCACCAGTTGGCAGTGGG + Exonic
1162787163 19:13042917-13042939 GAGGGTGTCAAGTTTCCAGATGG - Intronic
1162867772 19:13561834-13561856 TTGGGTCTCCAGCTTGCAGATGG + Intronic
1162880098 19:13652353-13652375 CTGGATCTCCAGCTTGGAGATGG - Intergenic
1162950702 19:14070708-14070730 CTGGGCCTCCAGCTTGGAGATGG - Intergenic
1162994347 19:14324538-14324560 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1163183066 19:15617642-15617664 CTGATTCTCCAGCTTGCAGAAGG - Intronic
1163324109 19:16592224-16592246 CAGGGTTTACAGTTGTCAGAGGG - Intronic
1163338538 19:16689232-16689254 AAGGGTCTCCACTATACAGATGG - Exonic
1163377153 19:16940214-16940236 CTGGGTCTCTATCTTGCAGAGGG + Intronic
1163443859 19:17335072-17335094 CAGGGTCCGGAGTTTGCAGATGG - Intronic
1163707166 19:18821283-18821305 CTGGGTCTCCAGCTTGCAAATGG + Intergenic
1164193364 19:22931842-22931864 CTGGGTCTCCTGCTTGCATAAGG + Intergenic
1164537414 19:29096215-29096237 CTGGTTCTGCTGTTTGCAGATGG + Intergenic
1164819961 19:31242302-31242324 CTGGGTCTCCAGCTTGCATATGG - Intergenic
1164880559 19:31729187-31729209 CTGGGTCTCCAGCTTGCAGAGGG + Intergenic
1165093872 19:33400259-33400281 GAGGGACTCCAGGCTGCAGAAGG + Intronic
1165124247 19:33582797-33582819 CCGGGTCTCCAGCTGGCAGGTGG - Intergenic
1165271587 19:34712197-34712219 GAGGGTCTCCAGTTTGCAGCAGG - Intergenic
1165721730 19:38083648-38083670 CAGTGTCTGCAATTTGCACATGG - Intronic
1165920476 19:39294667-39294689 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1166647746 19:44544721-44544743 CAGGTTCTTCATTTTGCAAATGG - Intergenic
1166963803 19:46515577-46515599 CTGGGTCTCCAGTATGGAGAAGG + Intronic
1167511105 19:49895756-49895778 CAGGGACTCCAGCCTGCAGCAGG + Intronic
1168047944 19:53807497-53807519 CAGGTTCTGAAGTTTGCAGTTGG + Exonic
1168208535 19:54871106-54871128 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1168529125 19:57113205-57113227 CAGGCTCCTCAGCTTGCAGACGG + Intergenic
924974342 2:159350-159372 CAGGGTCCCAAGTTTGTAAACGG - Intergenic
925438394 2:3862502-3862524 CTGGTTCTCCAGCTGGCAGAAGG - Intergenic
925540111 2:4957553-4957575 CAGTATCTCCATTTTACAGATGG - Intergenic
925569125 2:5289926-5289948 CTGGCCCTCCGGTTTGCAGATGG + Intergenic
925729972 2:6912772-6912794 CAGGGTCTCCAGCTTGCAGACGG - Intergenic
925770607 2:7279005-7279027 CTGGCTCTCCAGCTTGTAGAGGG + Intergenic
925872363 2:8282384-8282406 CCTGGTCTCCAGATTGCAGACGG - Intergenic
926301546 2:11608025-11608047 CACGGTCTCTAGATTCCAGAGGG + Intronic
926389669 2:12375545-12375567 TTGGGTCTCCAGCTTCCAGAGGG + Intergenic
926393265 2:12415697-12415719 TTGGTTCTCCAGCTTGCAGATGG + Intergenic
926687102 2:15706546-15706568 CTAGTTGTCCAGTTTGCAGATGG - Intronic
926714191 2:15911024-15911046 CAGTCGCTCCAGTTTGGAGAAGG + Intergenic
926842120 2:17092505-17092527 CTGGGTCTCCAGCTGGCAAAGGG + Intergenic
926963725 2:18387236-18387258 CTGGTTCTCCAGCTTGCAGTCGG + Intergenic
927147286 2:20174545-20174567 CAGTGCCTCCAGCTTGCACAGGG + Intergenic
927308849 2:21605379-21605401 CTGGTTTTCCAGCTTGCAGATGG - Intergenic
927606252 2:24490086-24490108 CAGGTTCCCCAGTTGGGAGAAGG + Intergenic
927845831 2:26472534-26472556 CATGGTCTCCAGTTTCTTGATGG + Exonic
928376825 2:30781705-30781727 CTGGGTCTCCAGATTGCAGGTGG + Intronic
928476205 2:31630068-31630090 CAGGGCCCCAAGTTTGCAAATGG + Intergenic
928599845 2:32893694-32893716 CTGGTTCTCCAGTTTGCAAATGG - Intergenic
928884688 2:36134873-36134895 CTGGTTCCCCAGCTTGCAGACGG + Intergenic
929199353 2:39218819-39218841 CTGGTTCTCTAGCTTGCAGATGG + Intronic
929549788 2:42882373-42882395 CTGGTTCTCTAGCTTGCAGATGG + Intergenic
929853511 2:45614707-45614729 CTGGCCCTCCAGCTTGCAGATGG + Intergenic
929958504 2:46478882-46478904 CAGGGACACCAGCTTGCAGATGG + Intronic
930105896 2:47639248-47639270 CTGGGCCTCCAGCTTACAGATGG - Intergenic
930272630 2:49274567-49274589 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
930284358 2:49409806-49409828 CTTGGTCTCCAGCTTGCAGGTGG - Intergenic
930324443 2:49897696-49897718 CTGGGTCTCCAGATTGCAGAGGG - Intergenic
930605074 2:53485091-53485113 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
930836940 2:55804089-55804111 TATTGCCTCCAGTTTGCAGATGG - Intergenic
930862749 2:56092007-56092029 TATGGTCTCCACTTTGCAGATGG - Intergenic
931195947 2:60052493-60052515 CTGGTTCTCCAGCTTGTAGAAGG - Intergenic
931209301 2:60177492-60177514 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
931466000 2:62487426-62487448 AAGGGAATCCAGTTTGCAGATGG - Intergenic
931666908 2:64616203-64616225 CAGCTTCTCCAGCTTCCAGATGG - Intergenic
931686976 2:64802454-64802476 CTGGGTCTGCAACTTGCAGATGG - Intergenic
931972712 2:67607217-67607239 CAGGGTCAAGAGTTTGCAGTTGG - Intergenic
932011694 2:67984240-67984262 CAGGGTCTCCATGGTGCAGTAGG + Intergenic
932267125 2:70377442-70377464 CAAGGTCTCCAGCTTGGAGGTGG - Intergenic
932943776 2:76202950-76202972 CAGGGTCTCCAGCTTAGAGATGG - Intergenic
933104857 2:78311483-78311505 CAGGTTATCCAAGTTGCAGATGG + Intergenic
933200545 2:79443207-79443229 TTAGGTCTCCAGCTTGCAGATGG - Intronic
933274277 2:80267067-80267089 CAGGCTCCCCAGTCTCCAGAGGG + Intronic
933310484 2:80654542-80654564 CCGGGTCTCCAGCTTGCAGATGG + Intergenic
933426914 2:82125696-82125718 CTGGCTCTCCAGCTTGTAGACGG - Intergenic
933872164 2:86577211-86577233 CTGGGTTTCCAGTTTGCAAATGG + Intronic
934154394 2:89182361-89182383 CAGTGTCTTCAGTCTGTAGAGGG + Intergenic
934212837 2:89999579-89999601 CAGTGTCTTCAGTCTGTAGAGGG - Intergenic
934578618 2:95419923-95419945 CCGGTTCTCCAGCTTGCAGATGG - Intergenic
934600823 2:95656786-95656808 CCGGTTCTTCAGCTTGCAGATGG + Intergenic
934618054 2:95787359-95787381 CTGGTTCTCTAGCTTGCAGAAGG - Intergenic
934642839 2:96037200-96037222 CTGGTTCTCTAGCTTGCAGAAGG + Intronic
934734708 2:96684084-96684106 CAGAGTCCCCAGTTTCCAGTGGG - Intergenic
934791036 2:97060275-97060297 TAGGGCATCCAGTTTGCAGAGGG + Intergenic
934815412 2:97322255-97322277 TAGGGCATCCAGTTTGCAGAGGG - Intergenic
934818939 2:97355205-97355227 TAGGGTATCCAGTTTGCAAACGG + Intergenic
934822283 2:97386228-97386250 TAGGGCATCCAGTTTGCAGAGGG + Intergenic
934965777 2:98720518-98720540 CTGGTTCTCCAGCTTGCAGGCGG + Intronic
935150832 2:100433688-100433710 CTGATTCTCCAGCTTGCAGAGGG + Intergenic
935187681 2:100748570-100748592 GAGGGTCTCTTGGTTGCAGAGGG - Intergenic
935190232 2:100771694-100771716 CTGGGTCTCCAGCTGGCAGACGG + Intergenic
935328051 2:101955795-101955817 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
935525189 2:104157091-104157113 CTGGTTCTCCTGCTTGCAGATGG - Intergenic
935712556 2:105912222-105912244 CTGGGTCTCCAGTATGCAGATGG + Intergenic
935803008 2:106717403-106717425 CTGGGTCTCCAGCTAGCAGGTGG - Intergenic
935863577 2:107360783-107360805 CAAAGTCTCCATTTTCCAGAGGG + Intergenic
936344985 2:111668739-111668761 CTGGGTCTCCAGCTTGTTGATGG - Intergenic
936380789 2:111984045-111984067 CTGGGTCTCCAGCTTCCAGATGG - Intronic
936494256 2:113004452-113004474 CAGGGTCTCCAGCTTGCAGGTGG - Intergenic
936534200 2:113298924-113298946 CCGGTTCTCCAGCTTGCAGATGG + Intergenic
936627557 2:114164503-114164525 CTGGGTTTCCAGCTTGCAGAAGG + Intergenic
936646023 2:114374120-114374142 TAGGGTCTCCAGCTTGCAGATGG - Intergenic
936859024 2:116993837-116993859 CTGGTTCTCCAGCATGCAGATGG + Intergenic
937666520 2:124494169-124494191 CAGTGTCTCCACCTTGCAAATGG - Intronic
937924966 2:127160957-127160979 CTGGGTCTCCAAATTTCAGATGG + Intergenic
938070143 2:128304121-128304143 CTGGTTCTCCAGCTTGCAGATGG + Intronic
938081393 2:128372137-128372159 CAGGGGCTCCAGTGTGCTGGGGG + Intergenic
938867477 2:135438085-135438107 CTGGGCCTCCAGTTTGCTGTTGG + Intronic
938976309 2:136481609-136481631 CTGGTTCTCCAACTTGCAGATGG + Intergenic
938982568 2:136540420-136540442 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
939009761 2:136832282-136832304 CCAGCTCTCCAGCTTGCAGATGG - Intronic
939228086 2:139388856-139388878 CTGGTTTTCCAGTTTGCAGATGG - Intergenic
939875612 2:147574028-147574050 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
939948395 2:148438690-148438712 CAGGATCTCCAGCTTGCAGATGG - Intronic
940215700 2:151301227-151301249 CTGGGGCTCCAGCTTGCAGATGG + Intergenic
940305416 2:152220815-152220837 CTGGTTCTCCAGCTTGCACATGG - Intergenic
940514456 2:154663585-154663607 CAGTTTCTCCAGTTTGCGGATGG + Intergenic
940718455 2:157255977-157255999 CTGGTTCTCCAGCTTGCAGGTGG - Intergenic
941045145 2:160666356-160666378 CAGGGTTTCCAGTCTTCAGACGG - Intergenic
941401185 2:165032826-165032848 CAGGGTCTCCTGTTTGAACTGGG + Intergenic
941416831 2:165231502-165231524 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
941492960 2:166165116-166165138 CTGGGTCTCCAGCTTACAGACGG - Intergenic
941532230 2:166684849-166684871 CTCAGTCTCCAGTTTGCAGGTGG - Intergenic
941966793 2:171308770-171308792 GTTGGTCTCCTGTTTGCAGATGG - Intergenic
942270156 2:174266399-174266421 CCAGGGCTCCAGATTGCAGAGGG - Intergenic
942502376 2:176605107-176605129 CAGGGTCTCGTGGTTACAGAGGG + Intergenic
942745701 2:179229445-179229467 CCAGGTCTCCAGTTTGCAGATGG + Intronic
942872610 2:180753527-180753549 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
942988227 2:182166598-182166620 CTGGCTCTCCAGCTTGCAGATGG + Intronic
943261219 2:185665964-185665986 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
943618806 2:190124123-190124145 CAGGGTCTCCAGATTGCAGATGG + Intronic
944235401 2:197437420-197437442 CAGGGCCTCTAGTTTGCAGATGG + Intergenic
944280024 2:197885266-197885288 TTGGGTCTCCAGCTTGTAGATGG - Intronic
944289689 2:197991320-197991342 CTGGGATTCCAGCTTGCAGATGG + Intronic
944424244 2:199563047-199563069 CAGGGTCTCTTGTTTGCAGATGG - Intergenic
944842379 2:203636769-203636791 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
945057183 2:205879260-205879282 CCGGGTCCCCAGCTTACAGATGG + Intergenic
945171271 2:206998043-206998065 CTGGATCTCTAGCTTGCAGATGG + Intergenic
945620680 2:212132680-212132702 TTGGGTCTCTAGCTTGCAGATGG + Intronic
945837667 2:214852121-214852143 CTGGGCCTCCAGCTTGCAGATGG - Intergenic
945906606 2:215600828-215600850 CTGGTTCGCCAGTGTGCAGATGG + Intergenic
945931821 2:215862979-215863001 CTGGCTCTCCAGTTTGCAGATGG - Intergenic
946565693 2:220962184-220962206 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
946725747 2:222659669-222659691 ATGGGTCTCCAGCTTGCAGATGG - Intergenic
946930616 2:224666787-224666809 CTGGGTCTCCAATTTACAGATGG - Intergenic
947044961 2:225971349-225971371 ACGGGTCTCCAGGTTGCAGATGG - Intergenic
947076029 2:226346946-226346968 CAGTTTCTCCAGCTTGCAGATGG + Intergenic
947233124 2:227909542-227909564 CTGATTCTCCAGCTTGCAGATGG - Intronic
947299382 2:228671890-228671912 CTGGGTCTCCAGCTTTCAGATGG - Intergenic
947759329 2:232592147-232592169 CAGGCCCTCCAGCTTGCAGGCGG + Intergenic
947920018 2:233862310-233862332 CTGGACCTCCAGCTTGCAGACGG - Intergenic
948276360 2:236712112-236712134 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
948533341 2:238627814-238627836 CTGGGTCTCCAGCCTGCAGGTGG + Intergenic
948877922 2:240840010-240840032 AAGACTCTCCAGTTTACAGATGG - Intergenic
948997183 2:241587483-241587505 CAGGGTTTCCAGCTTGTGGAGGG + Intronic
949014783 2:241702803-241702825 CAGGGTCTCCCGCTCGTAGAGGG + Intronic
1169196394 20:3684986-3685008 CTCGTTCTCCAGCTTGCAGATGG - Intergenic
1169249797 20:4051644-4051666 CAGAGTCTCCAGGTGGCACAAGG - Intergenic
1169368469 20:5010188-5010210 CAGGTTCCCCAGCTTGCAGACGG - Exonic
1170010512 20:11717453-11717475 CAGGGTCTCCAACTTGCTGATGG + Intergenic
1170291249 20:14771244-14771266 CTGGGTCTCTAGTTTGTAAATGG + Intronic
1170428129 20:16255899-16255921 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1170674854 20:18469482-18469504 CTGGGTCTCCAGCTTGCAGAGGG + Intronic
1170871173 20:20208106-20208128 CATCGTCTCCATTTTGCAGTGGG + Intronic
1170963060 20:21042528-21042550 CTGGGTCTCCAGCTTGCAAGTGG - Intergenic
1171169516 20:23002925-23002947 CCAGGTCTCCAGCTTACAGATGG - Intergenic
1171179498 20:23082097-23082119 CATGGTCTCCAGTTTTCAGTTGG - Exonic
1171193822 20:23181089-23181111 CATGGCCTCCACCTTGCAGAGGG - Intergenic
1172452868 20:35040570-35040592 CAGGTTCTCCAGCTTGCAGACGG + Intronic
1172875170 20:38159787-38159809 AAAGGACTCCATTTTGCAGATGG - Intronic
1172876876 20:38169771-38169793 CAGCGTGTCCACTTTGCAGATGG + Intergenic
1173281332 20:41631045-41631067 CTGGTTCTACAGCTTGCAGATGG + Intergenic
1173324665 20:42021656-42021678 CTGGGTCTCCAGTTTGTAAATGG + Intergenic
1173406208 20:42767453-42767475 CTGGATCTCCAGCTCGCAGATGG + Intronic
1173527191 20:43742234-43742256 CTAGGTCTCCAGTTTACAGATGG - Intergenic
1173747546 20:45449408-45449430 TATGGTCCCCAGTTTACAGAGGG + Intergenic
1173942789 20:46926331-46926353 CTGGGTCTCCAGGTTGCAAATGG - Intronic
1174012309 20:47459933-47459955 TCGGGCCTCCAGCTTGCAGATGG + Intergenic
1174524697 20:51161563-51161585 CTGGATCTCCAGCTTGCAGAGGG + Intergenic
1174738049 20:52984326-52984348 CAGGGTCTGGTGTTTGCAGAGGG + Intronic
1174883017 20:54301956-54301978 CAGGGGCTCCAGAATGTAGACGG - Intergenic
1175126368 20:56754938-56754960 TAGTGTTTCCAGCTTGCAGATGG + Intergenic
1175169118 20:57067601-57067623 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1175284742 20:57830548-57830570 CTGGGTCTCCAGCGTGCAGATGG - Intergenic
1175579058 20:60085098-60085120 TACGGTCTACAGTTAGCAGATGG + Intergenic
1175585298 20:60134319-60134341 CTGGGTCTCCAGCTTGCTAATGG + Intergenic
1175663784 20:60840644-60840666 CTGGATCTCCAGCTTGCAAAGGG + Intergenic
1176706208 21:10121339-10121361 CAGGGTCTCCAGGGTCCACAGGG - Intergenic
1177062059 21:16388442-16388464 CAGGATCTCCAGCTTGCAGGTGG - Intergenic
1177197341 21:17917329-17917351 CTGGTTCTCCAGCTTGAAGATGG + Intronic
1177330072 21:19647694-19647716 TTGGTTCTCCAGTGTGCAGAGGG + Intergenic
1177400110 21:20592839-20592861 CTGAGTCTCAAGCTTGCAGATGG + Intergenic
1177942612 21:27429870-27429892 CTGGTTCTCCAACTTGCAGATGG + Intergenic
1178110956 21:29369852-29369874 CTGGGTCTGCAGCTTGCAGATGG + Intronic
1178133618 21:29601336-29601358 CAGGGTCTCTAGTTTGCAGATGG + Intronic
1178134313 21:29609774-29609796 CTGGGTCTCCAGTTTGCAAATGG + Intronic
1178194296 21:30325778-30325800 CTGGTTCTCCATCTTGCAGATGG - Intergenic
1178268349 21:31166376-31166398 CAAGGTAGCCACTTTGCAGACGG - Intronic
1178564148 21:33667924-33667946 CAGGGGCTCCAGCAAGCAGATGG + Intronic
1178602123 21:34003851-34003873 CTGGGTCTCCAGCTTTCAGATGG - Intergenic
1178803711 21:35820562-35820584 CTGGGTCTCCAGCTTGCAGAAGG + Intronic
1178806392 21:35843157-35843179 CTGGTTCCCCAGCTTGCAGATGG + Intronic
1179361194 21:40710967-40710989 CAAAGGCTCCACTTTGCAGACGG + Intronic
1179433222 21:41339902-41339924 CAAGGTCTCCAGCTTGCAGATGG - Intronic
1179457713 21:41510531-41510553 CTGGGTCTCCAGTCTGTAGATGG - Intronic
1180012676 21:45061337-45061359 TAGTGTCTCTAGCTTGCAGATGG + Intergenic
1180012804 21:45062391-45062413 TAGGGTCTCTAGCTTGCAGATGG + Intergenic
1181385453 22:22542055-22542077 CAGGATCTCCAGCTTGCAGATGG - Intergenic
1182279280 22:29208691-29208713 CAGGTTCTGCATTTTACAGAGGG - Intronic
1182615883 22:31589948-31589970 CTGAGTCTCCAGCTTGCAGATGG - Intronic
1183016774 22:34995062-34995084 CTGGGTCTCCAGCTTGCACATGG - Intergenic
1183024300 22:35052505-35052527 CTGATTCTCCAGCTTGCAGATGG + Intergenic
1183109011 22:35634986-35635008 CTGGGTCTCCAGCTTGCAAATGG - Intronic
1183811409 22:40260870-40260892 CAATCTCTCCAGTTTGCTGAAGG - Intronic
1183981185 22:41541361-41541383 CAGGGACTGCAGCTGGCAGAGGG + Intronic
1184514861 22:44955720-44955742 CAGAGTCTCCAGTTTCCAGGTGG + Intronic
1184681548 22:46074841-46074863 AAGGGTCTCCAGGGTGCTGATGG + Intronic
1184883483 22:47327377-47327399 CTGGGTCTCCAGCTTGCCGATGG - Intergenic
1185046448 22:48530941-48530963 CAGGGGCACCACTTTGCACAGGG - Intronic
1185058479 22:48593297-48593319 CAGCCCCTCCATTTTGCAGATGG + Intronic
1185171742 22:49298351-49298373 CCGGGTCTCCAGCTCGCGGACGG - Intergenic
1185201557 22:49509164-49509186 CAGGGTATCCAGCTTGCAGACGG - Intronic
949585362 3:5431668-5431690 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
949838036 3:8290580-8290602 CAGGGTCTGCAGTCTTCATAGGG + Intergenic
949906254 3:8861134-8861156 CTGAGTCTCCAGCTTGCAAATGG + Intronic
949949274 3:9215905-9215927 CTGGATCTCCAGCTTGTAGATGG + Intronic
950807650 3:15620906-15620928 CAGGGTCTCCAGCTTGCAGATGG - Intronic
952004128 3:28822708-28822730 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
952190027 3:31013127-31013149 CTGGTTCTCCAGCTTGCTGAGGG + Intergenic
952410885 3:33048738-33048760 CAGGGGCTCCAGGGTGCAAAGGG + Intronic
952562050 3:34606022-34606044 CAGGATCTCCAGTTTGCAGATGG + Intergenic
952733895 3:36668885-36668907 CTGGGTCTTCAGCTTGCAGGGGG - Intergenic
952813066 3:37422460-37422482 CATGCTATCCACTTTGCAGAAGG + Intronic
953008015 3:38995718-38995740 CTGGTTCTCCAGCCTGCAGATGG + Intergenic
953166214 3:40467302-40467324 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
953395194 3:42563599-42563621 CAGGGTCTCCAGGAAGCAGAAGG + Exonic
953397409 3:42584030-42584052 CTGGTTCTCCAGCTTGTAGATGG + Intronic
953534413 3:43766402-43766424 CTGGTTCTCCAGCTTACAGATGG - Intergenic
953621506 3:44536718-44536740 CTGGGTCTCCAGCTTGCAGTTGG - Intergenic
953826597 3:46257786-46257808 CAGGGTCTCCAGCTTGTAGATGG - Intronic
954883481 3:53851844-53851866 CACTGTCTCCAGTTTACAGATGG - Intronic
955352115 3:58201218-58201240 CTGGGTCCCCAGTTCCCAGAGGG + Intronic
955636258 3:61032843-61032865 CTGGGCCTCCAGCTTGCAGATGG - Intronic
955644286 3:61119914-61119936 CTGAATCTCCAGCTTGCAGACGG + Intronic
955844418 3:63146674-63146696 ATGGTTCTCCAGTCTGCAGATGG + Intergenic
955868212 3:63408450-63408472 CTGGTTCTCCAGCTTGCAGATGG - Intronic
956407421 3:68942475-68942497 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
956565865 3:70638071-70638093 CTGGTTCTCAAGTTTGCAGATGG - Intergenic
956639869 3:71405466-71405488 CAGTATTACCAGTTTGCAGATGG + Intronic
956645698 3:71453605-71453627 CAGGCTCTCCAGGTTGGGGAGGG - Intronic
956721257 3:72119779-72119801 CTAGGTCTCCAGCTTGCAGACGG + Intergenic
956852022 3:73237660-73237682 CTGGGTCTGGAGCTTGCAGATGG - Intergenic
956908569 3:73793182-73793204 CTGGGTCTCCAGCTTTCAGGTGG + Intergenic
957117939 3:76050430-76050452 CTGGGTCCTCAGCTTGCAGATGG + Intronic
957266333 3:77970891-77970913 CTGGGTTTCCAACTTGCAGATGG + Intergenic
957334010 3:78803200-78803222 CATTGTTTCCTGTTTGCAGATGG - Intronic
957480633 3:80788914-80788936 CTTAGTCTCCAGGTTGCAGATGG + Intergenic
957677322 3:83384826-83384848 CTGGGTCTCCTGCTTGCTGATGG + Intergenic
958010521 3:87873204-87873226 CTAGTTCTCCAGCTTGCAGATGG - Intergenic
958141782 3:89571309-89571331 CCGAGTCTCCTGTTTGCTGAGGG - Intergenic
958187185 3:90136934-90136956 CTGTTTCTCCAGTTTGCAGATGG - Intergenic
958414903 3:93862213-93862235 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
958710528 3:97711480-97711502 CTGGTTCTCCAGCTTGCAGATGG - Intronic
958830311 3:99079366-99079388 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
959017736 3:101154831-101154853 CAGGGTCTCCAGCTGGCAGATGG - Intergenic
959287181 3:104429718-104429740 AAGTTTCTCCAGCTTGCAGATGG + Intergenic
959769867 3:110080662-110080684 CTGGTTCTACAGCTTGCAGATGG + Intergenic
960126159 3:114000421-114000443 TTGGGTCTCCAGATGGCAGATGG + Intronic
960394588 3:117120664-117120686 TAGAATCTCCACTTTGCAGATGG + Intronic
960420589 3:117440515-117440537 AAGCCTCTCCAGCTTGCAGATGG - Intergenic
960441353 3:117692832-117692854 CTGGTTCTCCAACTTGCAGACGG + Intergenic
961480782 3:127178588-127178610 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
961792059 3:129383406-129383428 CAGGCTCACCAGTTTGCACAGGG + Intergenic
961911614 3:130323035-130323057 CAGGGAATCCAGTGTGCAGGAGG + Intergenic
962156499 3:132953844-132953866 CTAGGTCTCCAGCTTACAGATGG + Intergenic
962455119 3:135558050-135558072 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
962476590 3:135760411-135760433 CTGGGTCTCCAGCTTACAGATGG + Intergenic
962749759 3:138425153-138425175 TCGGGTCTCTAGATTGCAGATGG + Intergenic
962844998 3:139266410-139266432 CAGGATCCCTAGTTTGCAAATGG + Intronic
962892459 3:139684324-139684346 CTGGCTCTCCAGCTTGCAGATGG - Intergenic
962895279 3:139708320-139708342 CTGGTTCTCTAGCTTGCAGATGG + Intergenic
962943070 3:140143281-140143303 CTGGTTCTCCAGCTTGCAGATGG - Intronic
963538258 3:146555486-146555508 TTGTGTCTCCAGCTTGCAGATGG - Intergenic
964145254 3:153453085-153453107 CTGGGTCTCCAGAATACAGAAGG + Intergenic
964164408 3:153684811-153684833 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
964625234 3:158752289-158752311 CTGGATCTCCAGCTTGCAGATGG + Intronic
964779082 3:160315283-160315305 CATTGTCTCCAGTGAGCAGAGGG + Intronic
965029081 3:163340610-163340632 CTTGCTCTTCAGTTTGCAGATGG - Intergenic
965100051 3:164284790-164284812 CTGGGTCTCCAGCTTACAGATGG + Intergenic
965145671 3:164899328-164899350 CAGGGTCTCCAACCTGCAGTTGG - Intergenic
965627261 3:170693864-170693886 CTGGTTCTCCAGCTTGCAGATGG + Intronic
965665709 3:171091373-171091395 CTGGGTCTCCAGCTTGCATATGG + Intronic
965914580 3:173827737-173827759 CTGGTTCTCCAGCTTGCAGATGG - Intronic
966043995 3:175528240-175528262 CTTGATCTTCAGTTTGCAGACGG - Intronic
966148396 3:176838523-176838545 CTGGTTCTCCAGTGTGCAGATGG + Intergenic
966394687 3:179490513-179490535 CAGGGTCTCCAGCTTGCAGACGG - Intergenic
966432501 3:179846899-179846921 CAGAGTCTCCAGTATGCAAATGG + Intronic
966485045 3:180459477-180459499 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
966497295 3:180595715-180595737 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
966859785 3:184224255-184224277 CAGGGTCTCCAGCTTGCAGAGGG - Intronic
967071708 3:185968184-185968206 CAGGTTCTCCAGATTCCATAAGG - Intergenic
967523312 3:190461993-190462015 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
967754150 3:193149594-193149616 CTGGCTCTTCAGTTTGCTGATGG + Intergenic
967813269 3:193778621-193778643 CAGCGTGTCCATCTTGCAGAGGG + Intergenic
967978983 3:195054198-195054220 CAGAGTCTCCTGTTTGCATTTGG - Intergenic
968134964 3:196214730-196214752 CAGGGTCTCCTCTTGGCAGTTGG - Intronic
968354031 3:198087615-198087637 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
968360939 3:198146392-198146414 CTGGTTCTCCAGCTTGTAGATGG - Intergenic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
968818206 4:2832585-2832607 CATGGCCCCCAATTTGCAGATGG - Intronic
969160405 4:5252780-5252802 TACTGCCTCCAGTTTGCAGATGG - Intronic
969241499 4:5901666-5901688 CAGGGTGTCCTGTGTGCAGTGGG + Intronic
969469579 4:7379599-7379621 ATGGGTGTCCATTTTGCAGATGG + Intronic
969664374 4:8548624-8548646 CTGGGTCTCCAGGTTGCAGACGG + Intergenic
969861123 4:10036015-10036037 CAGGGTCTCCAGCTTGCAGATGG + Intronic
969937744 4:10699098-10699120 CTGGGTCTCTAGCTTGCTGATGG + Intergenic
969983861 4:11186949-11186971 CATGCTCTTCAGCTTGCAGAAGG + Intergenic
970161462 4:13193427-13193449 CCGGGTCTCCAGCTTGCAAATGG + Intergenic
970231902 4:13919610-13919632 CAGAGTCTCTAGTTGGCAGGAGG - Intergenic
970249579 4:14100076-14100098 CTGGGTCTCCAGCTTGTAGAAGG + Intergenic
970305062 4:14722892-14722914 AAGGGTATTCTGTTTGCAGATGG + Intergenic
970701108 4:18739718-18739740 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
970878347 4:20898214-20898236 CTGGTTCTCCAGCTTGCAGGTGG + Intronic
970955766 4:21809406-21809428 CAGGTTCTCCAGCTTGCAGATGG + Intronic
970981634 4:22105894-22105916 CTGGTTCTCCAGTTTTCAGATGG - Intergenic
971072159 4:23106231-23106253 CTGGGTCCTCAGATTGCAGAGGG + Intergenic
971456636 4:26851223-26851245 CTGGGTCTTCAGGTTGCAGAGGG + Intergenic
971740196 4:30509492-30509514 CTGTGTCTCCAGCTTGCAAATGG + Intergenic
972222155 4:36968186-36968208 CTGGGTCTCCAGTTTCCAGATGG - Intergenic
972229134 4:37050096-37050118 CTGAGTTTCCAGCTTGCAGATGG - Intergenic
972272539 4:37524968-37524990 CAGGGTGTCCAGATTTAAGATGG + Intronic
972314702 4:37915339-37915361 CTGGGTATCCAGCTTGCAAATGG - Intronic
973030093 4:45326811-45326833 ATGGTTCTCCAGCTTGCAGATGG - Intergenic
973263030 4:48183691-48183713 CTGTGTCTCCACATTGCAGATGG + Intronic
973631882 4:52827174-52827196 CAGGGTCTTCAGCTTACAGATGG + Intergenic
973794608 4:54411723-54411745 TTGGTTCTCCAGTTTGCAGATGG - Intergenic
973984567 4:56337811-56337833 CTGGGTCTCCAGCGTGCAAATGG - Intergenic
974112551 4:57542558-57542580 CTAGTTCTCCAGCTTGCAGATGG - Intergenic
974195209 4:58565353-58565375 AAGTTTCTCCAGCTTGCAGATGG + Intergenic
974212041 4:58790670-58790692 CTGGGTATCCAGCTTGTAGATGG + Intergenic
974288711 4:59903671-59903693 CTGGGTCTTGAGTTTACAGATGG - Intergenic
974332312 4:60496704-60496726 TGGGGTCTACAGCTTGCAGATGG - Intergenic
974378715 4:61109692-61109714 CACGGTTTCCAGTTTGCATATGG + Intergenic
974625082 4:64415956-64415978 CAGGGTCTCCAGCTCGCAGATGG - Intergenic
974737181 4:65952026-65952048 CAGGGTCTGAAGCTTGCATACGG - Intergenic
974761250 4:66276916-66276938 CCTGGTCTCCAGCTTGCAGATGG + Intergenic
974847752 4:67371524-67371546 CTGGATCTCCAGCTTGCAGAGGG - Intergenic
974883417 4:67786860-67786882 CCAGGTCTCCAGCTTGCAGGTGG - Intergenic
975314461 4:72935097-72935119 ATGGGTCTCTAGCTTGCAGATGG + Intergenic
975742078 4:77439120-77439142 CAGGGTCTCCACCTTGCAGATGG + Intergenic
975746510 4:77480589-77480611 TAGTATCTCCAGCTTGCAGATGG + Intergenic
975764119 4:77649394-77649416 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
976013682 4:80523744-80523766 CTGGGCCTACAGCTTGCAGATGG + Intronic
976125495 4:81829813-81829835 CTGTGTCTCCAGGCTGCAGATGG - Intronic
976194232 4:82517736-82517758 CAGGGTCTCCATCTTGCAGATGG + Intronic
976253867 4:83080590-83080612 CAAGGTCTCCAGCTTTCGGATGG + Intergenic
976359906 4:84165628-84165650 CTGGGCCTCCAGCTTGCAGATGG + Intergenic
976431869 4:84971816-84971838 CAGGGTCTCTAGCTTGCAGATGG - Intergenic
976568058 4:86575245-86575267 ATGGGTCTCCAACTTGCAGATGG + Intronic
976598799 4:86918908-86918930 CAGGGTCTCCAGCTTGCAGATGG - Intronic
976759413 4:88532269-88532291 CTGGTTTTCCAGCTTGCAGAGGG - Intronic
977032771 4:91907821-91907843 CTGAGTTTCCAGCTTGCAGATGG - Intergenic
977337773 4:95719971-95719993 CTGGGTATCCAGCTTACAGAAGG - Intergenic
977363551 4:96037032-96037054 CTGGATCTCCAGCTTGCACATGG + Intergenic
977985021 4:103373035-103373057 CAGGGTCTCCAGCTTGCAAATGG - Intergenic
978052604 4:104220792-104220814 CTGGTTCCCCAGTTTGTAGATGG + Intergenic
978074229 4:104509059-104509081 CCTGGCCTCCAGCTTGCAGATGG + Intergenic
978429336 4:108617324-108617346 CTGGTTTTCCAGCTTGCAGATGG + Intergenic
978489177 4:109293025-109293047 CAGGGACTCCAGATTCCAGCTGG - Intronic
978495906 4:109358769-109358791 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
978579003 4:110213994-110214016 CTGGGTCTCCAGCTTGTAGATGG - Intergenic
978613152 4:110566596-110566618 TGGGATCTCCAGCTTGCAGATGG - Intergenic
978802623 4:112769952-112769974 CTGGCTCTCTAGCTTGCAGATGG + Intergenic
979022005 4:115513748-115513770 CTGGCTCTCCAGTTTGCAGATGG + Intergenic
979027129 4:115591991-115592013 CAGGGTCTCCAGCTTGTAGATGG - Intergenic
979088676 4:116449893-116449915 CTGGGTTTCCCATTTGCAGATGG + Intergenic
979118428 4:116859491-116859513 TTGGGTTTCCTGTTTGCAGATGG - Intergenic
979613274 4:122712159-122712181 CCAAGTCTCCAGCTTGCAGATGG + Intergenic
979625466 4:122840118-122840140 CATGTGCTCCTGTTTGCAGATGG - Intronic
979919237 4:126477909-126477931 CTGGGTCTGCAGCTTGCACACGG + Intergenic
979950466 4:126886419-126886441 CTGGTTCTCCAGTTTACAGATGG + Intergenic
980116812 4:128687175-128687197 CATGGTCCCCATTTTGTAGATGG + Intergenic
980225138 4:129973889-129973911 CTGGATCTTCAGCTTGCAGATGG - Intergenic
980431801 4:132709871-132709893 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
980526896 4:134000897-134000919 CTGGGTCTCCAGCTTTCTGATGG + Intergenic
980639413 4:135556085-135556107 CTGGTTCTCCAGCTTACAGATGG + Intergenic
980828897 4:138105726-138105748 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
981567146 4:146113670-146113692 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
981846332 4:149174635-149174657 CTGGTTCTCCAGTTTGCAGGTGG - Intergenic
981953977 4:150447551-150447573 CAGGGTCTCCAGCCTGCAGATGG + Intronic
982055647 4:151546372-151546394 CAAGGTCTCCAGCTTGCAGATGG + Intronic
982181484 4:152751956-152751978 CTGGGTCTCCTGTCTGCTGAGGG + Intronic
982344233 4:154339073-154339095 CTATGTCTCCAGCTTGCAGATGG - Intronic
982402792 4:154986397-154986419 CAGGGTCTCCAGCTTGCTGATGG + Intergenic
982456013 4:155610370-155610392 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
982606363 4:157521512-157521534 CTGGCTCCTCAGTTTGCAGATGG - Intergenic
982898146 4:160960637-160960659 CAGAGTCTCCAGCTTGGTGATGG + Intergenic
983432561 4:167670358-167670380 CAGGGACCCCAGCTTGCAGATGG - Intergenic
983768499 4:171518118-171518140 TTAGGACTCCAGTTTGCAGATGG + Intergenic
983844048 4:172494560-172494582 CCTGCTCCCCAGTTTGCAGAAGG - Intronic
983886769 4:172988704-172988726 CAGTGTCTCAAGATTGCACAAGG - Intronic
984564965 4:181318527-181318549 CTTGTTCTTCAGTTTGCAGATGG - Intergenic
984590888 4:181616616-181616638 CTGGTTCTCCAGCTTGCAGACGG - Intergenic
984620206 4:181944191-181944213 CTGGGGCTCCAGCTGGCAGATGG - Intergenic
985051349 4:185995458-185995480 CTGGTTCTCCAGCTTGCAGAGGG - Intergenic
985385828 4:189447357-189447379 CTTGTTCTCCAGCTTGCAGATGG + Intergenic
986057264 5:4150559-4150581 TTGGTTCTCCAGTTTGCAGATGG + Intergenic
986149161 5:5111021-5111043 CAGGATCTCCAGCTTACAGATGG + Intergenic
986173241 5:5330723-5330745 CTGGTTCTCCAGGCTGCAGAGGG + Intergenic
986226248 5:5817287-5817309 CTAGGTCTCCAGCTTTCAGATGG - Intergenic
986396156 5:7332952-7332974 CTGGGTTTCCAGCTTGCTGATGG - Intergenic
986428195 5:7655376-7655398 CTGGGCCTCCAGCTTGCAGAAGG - Intronic
986651876 5:9972086-9972108 TGGGGCCTCCAGCTTGCAGATGG - Intergenic
986886095 5:12238379-12238401 CTGGGCCTTCAGCTTGCAGATGG - Intergenic
987128114 5:14834239-14834261 CATTGTCTCCATTTTACAGATGG - Intronic
987542999 5:19278914-19278936 CTGGTTCTCCAGATTCCAGATGG - Intergenic
987546323 5:19314846-19314868 TAGGGTCTGCAACTTGCAGACGG - Intergenic
987963273 5:24838218-24838240 CTGGGTCTCCAGCCTGCAGATGG - Intergenic
988024809 5:25671287-25671309 CAGGCTCTCCAATTTGCAGATGG + Intergenic
988196485 5:28012087-28012109 GAGGGTTTCCAGTTTGCAGTGGG - Intergenic
988208565 5:28172743-28172765 CTGGGTCTCCAGCTTACAGATGG - Intergenic
988333124 5:29869049-29869071 CAGGGCCTCCAGCTTTCAGATGG - Intergenic
988582709 5:32482120-32482142 CAGGGTCCCCAGCTTGCAGATGG + Intergenic
988846524 5:35133232-35133254 CTGGGGCTCCAGCTTGCAGACGG + Intronic
989283050 5:39666869-39666891 CAGGTTCTCTAGCTTGAAGATGG - Intergenic
989314522 5:40062151-40062173 CTGGGTCTCCGGCTTGCAGGCGG + Intergenic
989352817 5:40506293-40506315 CTGGGTCTCCAATTTGCAGATGG + Intergenic
989451958 5:41597244-41597266 CTGGGTATCCAGCTTGTAGATGG - Intergenic
989699295 5:44242897-44242919 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
989955378 5:50352866-50352888 CTGGTTCTCCAGCTTGCAAATGG + Intergenic
989990465 5:50757970-50757992 CAGGGACTCCATTGTGCACAGGG + Intronic
990282968 5:54271175-54271197 CATGGTCTCCAGCTTGCAGATGG + Intronic
990559390 5:56968254-56968276 CTGGTTCTCCAGCTTGCAGATGG + Intronic
990715493 5:58632103-58632125 GAGGCACTCAAGTTTGCAGATGG + Intronic
991108997 5:62876346-62876368 CTGGGTCTCCAGCTTGCAGACGG + Intergenic
991369432 5:65902905-65902927 CACAGTCTCCAGTTTGCAGATGG + Intergenic
992034664 5:72760725-72760747 TGGGGTCTCTAGCTTGCAGATGG + Intergenic
992034815 5:72762643-72762665 CTGGGCCTCCAGATTGCAGATGG - Intergenic
992094406 5:73348379-73348401 CTGGGTCTCTAGCTTTCAGATGG - Intergenic
992103153 5:73426670-73426692 CAGGGTCTCCAGCTTTTGGACGG + Intergenic
992209434 5:74463296-74463318 CTGGTTCTCCAGTTTGCAGTCGG + Intergenic
992332282 5:75729650-75729672 TTGGGTCTCCAGCTTGCAGATGG - Intergenic
992357237 5:75998714-75998736 CTAGGTCTCCAGCTTGCAGATGG + Intergenic
992376964 5:76197801-76197823 CAGCATTTCCAGCTTGCAGAAGG - Intronic
992595582 5:78344094-78344116 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
992693098 5:79259251-79259273 CAGGGTCTCCTCTCTGCTGAGGG - Intronic
992948357 5:81832116-81832138 CTGGGTTTCCAGCTTGCAGATGG - Intergenic
993013216 5:82507620-82507642 CTGGGTCTCCAGCTTGCAATTGG + Intergenic
993106275 5:83604510-83604532 CTGTGTCTCCAGGTTGTAGATGG + Intergenic
993443848 5:87988526-87988548 CTGGTTCTCTAGCTTGCAGAAGG + Intergenic
993469380 5:88288327-88288349 CTGGTTCTCCAGTTTGCAGACGG - Intergenic
993596498 5:89863297-89863319 CTGTTTCTCCAGTTTGCAGAAGG - Intergenic
993635050 5:90332819-90332841 CTGGGTCTTCAGCTTACAGATGG + Intergenic
994036086 5:95202396-95202418 CTGGTTCTCCAGTTTGCAAATGG + Intronic
994373729 5:98994994-98995016 CAGAGCATCCAGTTTGCAGATGG + Intergenic
994440456 5:99796626-99796648 CAGTGTCTCCAGCTTGCAGATGG + Intergenic
994916254 5:105983064-105983086 CTGGGTCTCCTCTCTGCAGAGGG + Intergenic
994951166 5:106465178-106465200 CTGGGCCTCCAGCTTACAGATGG - Intergenic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
995405716 5:111793300-111793322 CTCGTTCTCCAGCTTGCAGATGG - Intronic
995483326 5:112614452-112614474 CTGGTTCTCCTGCTTGCAGATGG - Intergenic
995654605 5:114411426-114411448 CCCTGTCTCCAGCTTGCAGATGG - Intronic
996169350 5:120269555-120269577 CAGGGTCTCCAGCTCACAGATGG - Intergenic
996438747 5:123465213-123465235 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
996511245 5:124318667-124318689 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
997002642 5:129780679-129780701 CTGGGTCTTCAGCTGGCAGATGG + Intergenic
997074315 5:130654317-130654339 CTGGGCCTCCAGCTTGCAGATGG - Intergenic
997104280 5:131000769-131000791 CTGGGTCTCCAGCTTGCAGTGGG - Intergenic
997175042 5:131766639-131766661 TCGGGTCTCCACCTTGCAGATGG - Intronic
997179893 5:131817241-131817263 CTGGTTCTCCAGCTGGCAGATGG + Intronic
997639805 5:135441806-135441828 CAGGGTTTCCTGTTTCCAGATGG - Intergenic
997768754 5:136532352-136532374 CAGGGTCTCCAGCTTATAGATGG + Intergenic
997777892 5:136627818-136627840 CTGGTTCTGCAGCTTGCAGATGG + Intergenic
998323867 5:141260672-141260694 CTGGTTCTCCAGTTAGCAGATGG + Intergenic
998711876 5:144835204-144835226 TTGGATCTCCAGCTTGCAGATGG - Intergenic
998725213 5:145004861-145004883 CTGGTTCTCCAGCTTGAAGATGG - Intergenic
998925092 5:147114503-147114525 CTGGGTCTCCACCTTGCAGATGG - Intergenic
998971615 5:147598333-147598355 CTGGTTCTCCAGCGTGCAGATGG + Intronic
999105742 5:149069501-149069523 GAGGGGCTGCAGTTTTCAGAAGG + Intergenic
999146273 5:149397739-149397761 CAGGGTCTCCAGCTTGTAGACGG - Intronic
999877399 5:155823213-155823235 CTGGGTCTCCAGCTTGGAGAAGG - Intergenic
1000092117 5:157938886-157938908 CAGGGTCTCTAGCTTACAGATGG - Intergenic
1000098652 5:157993483-157993505 CTGGGCCTCCAGTTTGCAGATGG + Intergenic
1000158073 5:158571549-158571571 CAGGGTGACCAGTTTGAACATGG - Intergenic
1000423324 5:161062145-161062167 CAGGGTTTTCAGCTTGGAGATGG - Intergenic
1000580121 5:163026239-163026261 TTGGTTCTCCAGTTTGCAGGTGG - Intergenic
1000622058 5:163497066-163497088 CTGGGTCTCCAGCCTGCAAATGG - Intergenic
1000743702 5:165003245-165003267 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1001339703 5:170831946-170831968 CTAGGTCTCCAGCTTGCAAATGG - Intergenic
1001946569 5:175783768-175783790 CTGGGTCTCTAGCTTGCAGATGG - Intergenic
1002300636 5:178255660-178255682 AAGGGTCTCCAGCCTGCACAAGG - Intronic
1002667430 5:180835459-180835481 CTGATTCTCCAGCTTGCAGATGG + Intergenic
1003714374 6:8630084-8630106 CTGGATCTCATGTTTGCAGATGG + Intergenic
1004308509 6:14522893-14522915 CTGAGTCTCCAGGTTGCAGATGG - Intergenic
1004455346 6:15786739-15786761 CAGGGTCTCTGGTGTGCAAATGG + Intergenic
1004691948 6:17999728-17999750 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
1004835961 6:19531794-19531816 CAGGGTTTCCAGCTTGTAGATGG + Intergenic
1005031197 6:21510715-21510737 CAGGGCCTCCTGACTGCAGATGG - Intergenic
1005151284 6:22754168-22754190 CTGGGTCCCCAGCTTGCAGACGG + Intergenic
1005506203 6:26470866-26470888 CAGGGTCTCCAGCTTGCAGATGG + Intronic
1005512973 6:26528828-26528850 CTGGGGCTCCAGCTAGCAGATGG - Intergenic
1005723748 6:28628836-28628858 TTGGGTCTCCAGCTTGCAGATGG - Intergenic
1006234387 6:32615922-32615944 CTGGGTCTCCTACTTGCAGATGG - Intergenic
1006914922 6:37588000-37588022 CAGGGGCTCCGCTTCGCAGAGGG - Intergenic
1006943631 6:37769551-37769573 CTGGTCCTCCAGCTTGCAGATGG + Intergenic
1007000478 6:38307575-38307597 AAGGGGCTCCAGTTTTCAAAAGG - Intronic
1007061409 6:38944224-38944246 CTCTGTCTCCAGGTTGCAGAGGG + Intronic
1007212517 6:40206706-40206728 CAGTGGCTCCAGTTTCAAGATGG + Intergenic
1007281813 6:40718528-40718550 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1007294054 6:40807848-40807870 CCTGCTCTTCAGTTTGCAGATGG + Intergenic
1007484287 6:42170154-42170176 CTGGTTCTCCATCTTGCAGATGG - Intronic
1008006033 6:46410240-46410262 CAGGTTCTCCAATTTGCAGAAGG + Intronic
1008234487 6:49027192-49027214 CTGGTTCTTCAGCTTGCAGATGG + Intergenic
1008663987 6:53697774-53697796 CACAGTCTCCAGTTTGCAAAAGG - Intergenic
1009034110 6:58095885-58095907 CTGGTTCTCCAGCTTGAAGAAGG - Intergenic
1009209718 6:60847590-60847612 CTGGTTCTCCAGCCTGCAGAAGG - Intergenic
1009970853 6:70624233-70624255 CTGGGTCTCCAGTTTACTGATGG + Intergenic
1010003036 6:70967370-70967392 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1010467981 6:76191223-76191245 CTGGTTCTCCAGCTTGCGGATGG + Intergenic
1010614821 6:77999834-77999856 CAGGGCCTTCAGCTTGCAGATGG + Intergenic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1010870486 6:81031288-81031310 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1011318439 6:86063070-86063092 CAGGTTGTTCAGTTTGCAGGTGG + Intergenic
1011422130 6:87184690-87184712 CAGAGTCTCTGGCTTGCAGATGG - Intronic
1011653292 6:89526720-89526742 CTGGGTCTCCAGCATACAGATGG - Intronic
1011728443 6:90234789-90234811 CAGGATGTACAGTTTGCAAAGGG + Intronic
1011738939 6:90340121-90340143 CTGGTTCTCCAGATTGCAGATGG + Intergenic
1011785395 6:90837821-90837843 CTGGGTCTCCAGCTTGCTGATGG + Intergenic
1011850993 6:91628488-91628510 CAGGGTTTCCAGATCTCAGATGG + Intergenic
1011895073 6:92215543-92215565 TTGGTTCTCCAGCTTGCAGAGGG - Intergenic
1012054210 6:94384343-94384365 CAGAGTCTTCAGCTTGCAAATGG + Intergenic
1012161995 6:95897265-95897287 CCAGTTCTCCAGCTTGCAGATGG + Intergenic
1012321366 6:97850942-97850964 AAGAGTCTCCAGTTTACAAAGGG + Intergenic
1012419722 6:99051135-99051157 CTGGTTCTCCAGCTTCCAGATGG + Intergenic
1012422628 6:99081314-99081336 CAGGTTCTGCAGCTTGCAGATGG - Intergenic
1012471579 6:99578485-99578507 CTGGATCTCCAGCTTGAAGATGG - Intergenic
1012530073 6:100225106-100225128 CTCGTTCTCCAGTTTGCAGATGG - Intergenic
1012827966 6:104169531-104169553 TTGGGTCTCCAGCTTGCAGAAGG + Intergenic
1012846468 6:104395671-104395693 CTGGGTCTCCAGTTTACAGACGG + Intergenic
1013093116 6:106919348-106919370 CAGTGTCTCCATTTTACAGAGGG + Intergenic
1013126887 6:107192670-107192692 CCGGGTCTCCCGCTTGGAGAAGG - Intronic
1013430589 6:110051675-110051697 CTGGGCCTCCAGCTTGCAGATGG + Intergenic
1014003238 6:116388172-116388194 CTGGGTCTCCAGAGTGCAAATGG - Intronic
1014136081 6:117891528-117891550 CTGGGTATCCAGCTTGTAGATGG + Intergenic
1014161894 6:118179247-118179269 CTAGTTCTCCAGCTTGCAGATGG - Intronic
1014399313 6:120967345-120967367 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1014924248 6:127252692-127252714 CTAGGCCTCCAGCTTGCAGATGG - Intergenic
1015273325 6:131359329-131359351 CTGGTTCTCCGGCTTGCAGATGG - Intergenic
1015275397 6:131378626-131378648 CTGGGTCTCCAGCTTGCGGATGG + Intergenic
1015519820 6:134118918-134118940 CAGAGTCTCCAGATTGCAGATGG - Intergenic
1015581891 6:134734519-134734541 CAGGGTCTCTGGCTTTCAGATGG - Intergenic
1015939514 6:138433546-138433568 CAGGGACTCCAGCTGTCAGACGG - Exonic
1016079693 6:139840604-139840626 CTGAATCTCCAGTTTGCAGATGG + Intergenic
1016093174 6:140003625-140003647 CAGGGTCTCCAGCTTGCCAATGG + Intergenic
1016158971 6:140852357-140852379 CTGGGTCTCCAGCTTGCAGAGGG - Intergenic
1016512608 6:144860257-144860279 CCGGCTCCCCAGCTTGCAGATGG + Intergenic
1016595015 6:145789089-145789111 CTGGCTCTCCAGCTTGCAGATGG + Intergenic
1016932241 6:149422787-149422809 CAGGGTCTTCAGTGCACAGAGGG - Intergenic
1017562092 6:155639123-155639145 CAGAGTGTCCAGCCTGCAGATGG - Intergenic
1017667978 6:156739914-156739936 CTGGGGCTCCAGCTTACAGAAGG - Intergenic
1017899980 6:158711452-158711474 CAGGGTCTCCAGTTTGCAGATGG - Intronic
1017936949 6:159014328-159014350 CCGGGTCTCCGGCTTGCAGATGG - Intergenic
1018220361 6:161572025-161572047 CTGGTTTTCCAGCTTGCAGATGG + Intronic
1018225101 6:161621285-161621307 CAGGGTCTTCAGCTTGTAGATGG - Intronic
1018440889 6:163812165-163812187 CTGGTTCTCCAGCTTGCAGTTGG + Intergenic
1018589802 6:165407022-165407044 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1019159355 6:170058702-170058724 GAGGGACTGCACTTTGCAGAGGG + Intergenic
1019259070 7:70262-70284 CTGGTTCTCCAGCTTGTAGATGG + Intergenic
1019478944 7:1257211-1257233 CAGCCTCTCCACTTTACAGAAGG - Intergenic
1019847827 7:3524205-3524227 CAGGGGCACCAGTTTGTATAGGG + Intronic
1019975944 7:4581679-4581701 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1020355115 7:7267079-7267101 TTGGGTCTCCAGCTTGCAGATGG + Intergenic
1020473501 7:8566759-8566781 CAGAGTCTCCAGCTTACAGGTGG + Intronic
1020499922 7:8904734-8904756 CTGGGTCTTCAGTTTGCAGATGG + Intergenic
1020883454 7:13793103-13793125 CAGAGTCTCCAGCTTGAAGATGG + Intergenic
1021075378 7:16297830-16297852 CTGGGCCTCCAGCTTGCAGCTGG + Intronic
1021813250 7:24424138-24424160 TGGAGTCTCCAGTCTGCAGAGGG + Intergenic
1022106584 7:27201253-27201275 TAGGATCTCCAGCCTGCAGAGGG + Intergenic
1022260850 7:28703537-28703559 CTGGGTCTCCAGCTGGCAGATGG - Intronic
1022316400 7:29249151-29249173 CAGAGTCTCCAGCTTGCAGATGG - Intronic
1022370044 7:29761892-29761914 TTGGGCCTCCAGTTTGTAGATGG + Intergenic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022846598 7:34216147-34216169 CTGGCTCTCCAGCTTGCAGGTGG - Intergenic
1023133334 7:37025716-37025738 CTGGGTCTCCAGCTTTCAGATGG + Intronic
1023184576 7:37519535-37519557 TTGGGTCTCCAGCTTGCAGATGG + Intergenic
1023194428 7:37618446-37618468 CTGGTTCTTCAGCTTGCAGATGG + Intergenic
1023534592 7:41194934-41194956 CTGGTTTTCCAGTGTGCAGAGGG - Intergenic
1023661099 7:42471671-42471693 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1024113689 7:46172610-46172632 CAGGGTCTCCAGCTTACTCATGG - Intergenic
1024192931 7:47031085-47031107 CAGGGTCGCCAGGAGGCAGAGGG + Intergenic
1024207721 7:47178072-47178094 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1024406639 7:48989822-48989844 CAGGTTCTCCAGATTAAAGATGG - Intergenic
1024492318 7:49999521-49999543 CTGGTTCTCCAGCTTGCAGATGG - Intronic
1024610730 7:51061852-51061874 CGGGGTCTCCAGCTTACAGATGG + Intronic
1025106737 7:56176779-56176801 CTGGGTCTCCAGGTTGCACGTGG - Intergenic
1026245254 7:68613853-68613875 CTGGGTCTCTAATTTGCAGTTGG + Intergenic
1026291749 7:69013283-69013305 CCTGGTCTCCGGTTTGCAGATGG - Intergenic
1026306933 7:69150570-69150592 CACTGTCTCCAGTCTGCATATGG - Intergenic
1026311533 7:69189591-69189613 CTGGGTCTCCAGGTTGCAGGTGG + Intergenic
1026348934 7:69498833-69498855 CTAGTTCTCCAGCTTGCAGATGG - Intergenic
1026391311 7:69905420-69905442 CAGGGTCTCCATCTTGCAGATGG - Intronic
1027174437 7:75894204-75894226 CAGGGGCTGCTGTTGGCAGAGGG + Intergenic
1027830219 7:83167330-83167352 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1027879983 7:83822344-83822366 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1027957705 7:84902593-84902615 CAGAATCTCCAGCTTGCAGATGG + Intergenic
1028068643 7:86420846-86420868 CTGGATCTCTAGCTTGCAGAGGG + Intergenic
1028122183 7:87068801-87068823 CTGGGTCTCTAGTTTGCAGAAGG - Intergenic
1028303749 7:89234884-89234906 CTGGTTCTCCACCTTGCAGATGG + Intronic
1028962912 7:96769642-96769664 CTGGTTCTCCAGTTTGCTGATGG + Intergenic
1028978177 7:96937379-96937401 TTGGGTCTCCAACTTGCAGACGG - Intergenic
1029036866 7:97531781-97531803 CTGGTTCTCTAGTTTTCAGATGG - Intergenic
1029089205 7:98035051-98035073 CCAGTTCTCCAGCTTGCAGATGG - Intergenic
1029355442 7:100048429-100048451 CAGGGTTCCCATTATGCAGATGG - Intergenic
1029862060 7:103583253-103583275 CAGGGTCTCCAACTTGCAGATGG + Intronic
1030243840 7:107359834-107359856 CAGGATGACCAGCTTGCAGATGG + Intronic
1030550232 7:110949108-110949130 CAGGGTCTCCAGCTTGCAGGTGG + Intronic
1030646427 7:112066387-112066409 CTGGTTTTCCAGCTTGCAGATGG + Intronic
1030784869 7:113646667-113646689 CTGGTTCCTCAGTTTGCAGATGG - Intergenic
1030841018 7:114354285-114354307 CTGGTTCTTCAGCTTGCAGATGG + Intronic
1031151142 7:118055895-118055917 CTGAGTCACCAGCTTGCAGATGG + Intergenic
1031174472 7:118332267-118332289 CTGGTTCTCCAGCTTGCAGGTGG + Intergenic
1031561382 7:123242939-123242961 CTGGTTCACCAGCTTGCAGATGG - Intergenic
1031606302 7:123772088-123772110 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
1032841562 7:135717997-135718019 CTGGGTCTCCAGCTTGCAAGTGG + Intronic
1032857410 7:135846782-135846804 CTGGGTCTCCAGCTTGCAGGTGG - Intergenic
1032862888 7:135898388-135898410 CTGGGCCTCCAGCTTGCAGATGG - Intergenic
1033496529 7:141902863-141902885 CTGGGTCTCCAGCTTTCAGATGG - Intergenic
1033656733 7:143380516-143380538 CCGGGTCTCCAGTCCGCAGGCGG + Intergenic
1033807517 7:144972007-144972029 CAGGATATCCAATTTGCAGGTGG - Intergenic
1034071523 7:148190640-148190662 CTGGTTCTCCAGGTTGCAGACGG - Intronic
1034072485 7:148199844-148199866 CTGGTTCTCCAGCTTGCAGATGG - Intronic
1034523586 7:151639788-151639810 CAGGGACTCCAGCTTGGAGATGG + Intronic
1034647882 7:152664660-152664682 CTGGTTCTCCAGCTTGCAGATGG + Intronic
1034717041 7:153253012-153253034 CCAGGTCTCCAGCCTGCAGAGGG + Intergenic
1034996184 7:155578482-155578504 CTGGGTCTCCAGCATGCAGATGG + Intergenic
1035055293 7:156031256-156031278 CTGAGTCTCCAGTGGGCAGAAGG - Intergenic
1035060369 7:156064780-156064802 CACGGCCTCCAGTTTGAACAAGG + Intergenic
1035126499 7:156611745-156611767 TGGGGTCTCCAGCATGCAGACGG - Intergenic
1035477171 7:159152097-159152119 CTGGTGCTCCAGCTTGCAGAGGG - Intergenic
1035642810 8:1196943-1196965 CTGGGTCTCCAGCTTGTGGATGG - Intergenic
1035779110 8:2213432-2213454 CTTGTTCTCCAGCTTGCAGATGG + Intergenic
1037182414 8:16023766-16023788 CTGTGTCTCCAGCTTGCAGATGG - Intergenic
1037227123 8:16605761-16605783 CTGGTTTTCCAGTTTACAGATGG - Intergenic
1037384695 8:18326059-18326081 CCGAGTCTCCAGTTTACAGATGG - Intergenic
1037432277 8:18826239-18826261 CTGGGTCTCCAGCTCGCAGATGG + Intronic
1037545901 8:19922001-19922023 CTGGGTCTCCAGCTTGCAGATGG + Intronic
1037670460 8:21011237-21011259 CTGGACCTCCAGCTTGCAGATGG - Intergenic
1037685105 8:21131794-21131816 GTGGGTCTGCAGCTTGCAGATGG + Intergenic
1037963807 8:23118091-23118113 CAGGGTCCCCAGTACGCAGCTGG - Intergenic
1037973308 8:23190768-23190790 CAGGGTCTCTGCTGTGCAGATGG - Exonic
1038051700 8:23820190-23820212 CTGGTTCTCCAGCTTTCAGAGGG - Intergenic
1038060402 8:23905957-23905979 CAGGGTTTCCACTTTGCAAGAGG - Intergenic
1038393708 8:27230950-27230972 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1038453009 8:27651773-27651795 CAGTGTCTGCAGTTTGCATTAGG - Intronic
1038660480 8:29492672-29492694 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1039055442 8:33532712-33532734 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1039526742 8:38223740-38223762 CAGGGTCTCCAGCTTGCAGATGG - Intergenic
1039575523 8:38620689-38620711 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1039826279 8:41176567-41176589 CAGGGTCTCCAGCTTGTGGATGG - Intergenic
1039839167 8:41281216-41281238 CAAGGCCTCCAGTTTGCATCAGG + Intronic
1040388002 8:46926557-46926579 CTGGGTCTCCAACTTGCACACGG + Intergenic
1040548099 8:48417507-48417529 CAGGGGCTCCACTCTCCAGAGGG + Intergenic
1040623200 8:49113006-49113028 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1040646586 8:49403840-49403862 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1040652362 8:49464107-49464129 CTGGTTCTCCAGCTTGCAAATGG - Intergenic
1040759024 8:50815185-50815207 CTGTGTCTCCAGCTTGCAGATGG - Intergenic
1040828015 8:51645038-51645060 CTGGGTCTTCAGCTTGCAGAGGG - Intronic
1040998940 8:53430574-53430596 CTGGACCTCCAGCTTGCAGAGGG + Intergenic
1041815152 8:61962156-61962178 CTGGGTCTCCTGCTTGCAGGTGG + Intergenic
1042024418 8:64407721-64407743 CTGGGACTCCAGTTTGCAGATGG - Intergenic
1042068315 8:64903019-64903041 CTGGTTCTTCAGTTTGCAGATGG + Intergenic
1042219363 8:66458387-66458409 CAGGGGCTCCATTTCCCAGAGGG + Intronic
1042481490 8:69308515-69308537 CATGCTTTCCAGTTTGCAAAGGG + Intergenic
1042492510 8:69416226-69416248 CAGGGTCTCCAGCTTACAGATGG - Intergenic
1042538228 8:69880700-69880722 CTCTTTCTCCAGTTTGCAGATGG + Intergenic
1042701823 8:71623954-71623976 CAGTATCTCCATTTTGCAAATGG + Intergenic
1042840972 8:73123536-73123558 CTGGCTCTTCAGCTTGCAGATGG - Intronic
1043120697 8:76319687-76319709 CTGGCTGTCCAGCTTGCAGAGGG - Intergenic
1043145991 8:76655095-76655117 CTGGTTCTCTAGCTTGCAGATGG + Intergenic
1043195554 8:77287729-77287751 CAGGGTCTCCTTTCTGCTGAGGG + Intergenic
1043293463 8:78634554-78634576 CTGGATCTCCAGGTTGCAGAGGG - Intergenic
1043307761 8:78818312-78818334 CTGGTTCTCCAGCTTGCAAACGG - Intergenic
1043360299 8:79464343-79464365 CTGGTTCTCCAGCTTACAGATGG - Intergenic
1043360647 8:79467793-79467815 CTATGTCTCCAGCTTGCAGATGG + Intergenic
1043676251 8:82958314-82958336 CTGGTTCTCCAGTTTGAAGATGG + Intergenic
1043910096 8:85854263-85854285 CACGGTCTCCAGTTTGCAGATGG - Intergenic
1043974910 8:86573662-86573684 CAGGGACTCCAGTTTGTAGATGG - Intronic
1044051373 8:87509887-87509909 CCAAGTCTCCAGTTTGCAGATGG + Intronic
1044082712 8:87904837-87904859 TTGGGTCTCCAGCTTGTAGACGG - Intergenic
1044405906 8:91825691-91825713 CCGGGTCTCCACTGTCCAGATGG + Intergenic
1044556040 8:93563157-93563179 CAGGTTCTCCAGCTTGCAGATGG - Intergenic
1044612228 8:94104302-94104324 CGGGGCCTCCAGCTTGCAGATGG - Intergenic
1044740216 8:95318667-95318689 CTGGTTCTCCAGCTTGCAGATGG + Intergenic
1045051768 8:98333910-98333932 CCAGGTCTCCAGTGTGCAGATGG + Intergenic
1045235598 8:100350383-100350405 CGGGTTCTCCAGCTTGCAGATGG + Intronic
1045256429 8:100527865-100527887 CATGGTCTCCAGTTTCGAGTGGG + Exonic
1045497067 8:102717807-102717829 CTGGCTCTCCAGCTTGCAAATGG + Intergenic
1045573175 8:103391154-103391176 CTGGTTCTCCAGTTTGCAAATGG - Intergenic
1045720874 8:105109248-105109270 CAGAGTTTCCAGCTTGCAGATGG + Intronic
1046025179 8:108713784-108713806 CAGGGTCTCCAGCTTGCAGATGG - Intronic
1046035810 8:108840141-108840163 CTGGGTCTCCAGCTTGGAGATGG - Intergenic
1046695474 8:117334659-117334681 CTGGTTCGCCAGCTTGCAGATGG - Intergenic
1047038325 8:120964702-120964724 CAGGGTCTCTAACTTGCAGATGG - Intergenic
1047596458 8:126382522-126382544 CAGTTTCTCCACATTGCAGATGG - Intergenic
1048202307 8:132384832-132384854 CAGTGTTTCCATTTTACAGATGG - Intronic
1048656062 8:136537307-136537329 CTGGTTTTCCAGCTTGCAGATGG + Intergenic
1048716893 8:137281158-137281180 CTGGGTCTCCAACTTACAGAAGG + Intergenic
1049035135 8:140069759-140069781 CTGGTTCTCCAGCTTGCAGGCGG - Intronic
1049101595 8:140583275-140583297 CAGGGTCTCCAGCTTGTAAATGG + Intronic
1049311725 8:141937152-141937174 GAGGGTATCCAGGTTGCAGAGGG + Intergenic
1049324457 8:142014820-142014842 CAGGCTCTCCCCTTTGCAGTTGG - Intergenic
1049588150 8:143441328-143441350 CAGGGCCTACAGTTGGCTGAGGG - Intronic
1049617266 8:143581111-143581133 CCGGGCCTCCAGCTTGGAGATGG + Exonic
1049619163 8:143590043-143590065 CACGGTCTCCAGGGTGCAGGAGG + Exonic
1049941904 9:554172-554194 CTTGTTCTCTAGTTTGCAGATGG - Intronic
1050027425 9:1350396-1350418 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1050102652 9:2135056-2135078 CTGGGTCTCCAACTTGCAGGTGG - Intronic
1050371079 9:4922032-4922054 CCTGGTCTCCAGCTTGCAGATGG - Intergenic
1050665251 9:7928521-7928543 CTGGCTCTCCAGCTTGCTGAGGG - Intergenic
1050874577 9:10617965-10617987 CTGGTTCTCCACCTTGCAGATGG + Intergenic
1050961402 9:11738029-11738051 CTGAGCCTCCAGCTTGCAGAAGG - Intergenic
1050978182 9:11968940-11968962 CTGGCTCTCCAGCTTGCAGATGG + Intergenic
1051024761 9:12595176-12595198 CTGGGTCTCCAATATGCAGATGG - Intergenic
1051333956 9:16049704-16049726 CCGGGTCTCCAGCTTGCAGATGG + Intronic
1051562166 9:18454099-18454121 TAGGGTCTCCAGCTTAGAGATGG - Intergenic
1051741703 9:20258676-20258698 CTGGTTCGCCAGCTTGCAGATGG + Intergenic
1051832306 9:21293402-21293424 CAGGGTCTCCAGCTTACAGATGG + Intergenic
1051949339 9:22612045-22612067 CACGTTCTCCAGCTTGCAGGTGG + Intergenic
1051971464 9:22892355-22892377 CTGGTCCTCCACTTTGCAGATGG + Intergenic
1052055562 9:23903028-23903050 CAGGCTCTCTACCTTGCAGACGG + Intergenic
1052168579 9:25364591-25364613 CTGGTTCTCCAGCTTGCATATGG + Intergenic
1052300227 9:26945684-26945706 CAGGTTATGGAGTTTGCAGATGG - Intronic
1053418540 9:37962173-37962195 CAGGGTCTCCCGCTTACAGGGGG - Intronic
1053461480 9:38274594-38274616 CTGGTTCTCCAGCTTGCTGATGG + Intergenic
1053643493 9:40108456-40108478 CAGGGTCTCCAGGGTCCACAGGG - Intergenic
1053762658 9:41357034-41357056 CAGGGTCTCCAGGGTCCACAGGG + Intergenic
1054324348 9:63705684-63705706 CAGGGTCTCCAGGGTCCACAGGG - Intergenic
1054541259 9:66268148-66268170 CAGGGTCTCCAGGGTCCACAGGG + Intergenic
1054718404 9:68580271-68580293 CTGGGTCTCTCATTTGCAGATGG + Intergenic
1055204538 9:73712146-73712168 CAGCCTCTCCAGCCTGCAGATGG + Intergenic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1055223239 9:73964167-73964189 CTGGGCCTCCAGCTTGCAAATGG + Intergenic
1056009918 9:82317173-82317195 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1056048398 9:82742981-82743003 CTAGTTCTCCAGATTGCAGATGG - Intergenic
1056192275 9:84196017-84196039 CTGGTTCCCTAGTTTGCAGATGG + Intergenic
1056462875 9:86825197-86825219 CTGGTTCTCCAGCTTGCAGATGG - Intergenic
1056525656 9:87440723-87440745 CAGGGTCTGCAGCTTGCAGATGG - Intergenic
1056808606 9:89746924-89746946 CTGGGTCTCTGGCTTGCAGATGG - Intergenic
1056872217 9:90292414-90292436 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1056936363 9:90917929-90917951 CTGGGTCTCCAACCTGCAGATGG + Intergenic
1056964180 9:91152334-91152356 TTGGGTCTCCAGTTTGCAGATGG - Intergenic
1057073524 9:92121198-92121220 CTGGTTCTTCAATTTGCAGATGG - Intergenic
1057319433 9:93998910-93998932 CTGGGTCTCCATCTTGCAGAGGG - Intergenic
1057336547 9:94160150-94160172 CTGGGTCACCAGCTTGCAGATGG - Intergenic
1057498659 9:95579672-95579694 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1057586058 9:96329959-96329981 CAGGGTCTCCAACTTGCAGATGG - Intronic
1057993624 9:99799148-99799170 CTGGGTCTCCAGCTTGCAGGCGG - Intergenic
1058340200 9:103886100-103886122 CAGGGTCTCCAGCTTGCAGATGG + Intergenic
1058712556 9:107693558-107693580 CATTGCCTACAGTTTGCAGAGGG - Intergenic
1060017025 9:120095707-120095729 CTGGGCCTCCAGCTTGTAGATGG - Intergenic
1060103704 9:120860773-120860795 CAGGGTCCTGAGTTTTCAGATGG + Intronic
1060134194 9:121136001-121136023 CAGGGTCCTTAGTTTGCAGTTGG - Intronic
1060165527 9:121411055-121411077 TTGGTTCTCCAGCTTGCAGATGG + Intergenic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1060274040 9:122168892-122168914 CTGGGCCTCCAGGTTGCAGAGGG - Intronic
1060529240 9:124338766-124338788 CAGTATCTCCATTTTCCAGATGG - Intronic
1061004868 9:127923077-127923099 CAGCAACCCCAGTTTGCAGATGG + Intronic
1061108101 9:128547878-128547900 CTGGGTTTCCAGCTTGCAGATGG - Intergenic
1061472474 9:130837317-130837339 CATCATCTCCACTTTGCAGATGG + Intronic
1061661763 9:132134987-132135009 CTGGGTCTCTAGCTTGCAGATGG + Intergenic
1061721912 9:132557167-132557189 CAGGGGCTCCAAGGTGCAGACGG + Intronic
1062038199 9:134392105-134392127 CAGAGCCTCCATTTTGCAGAGGG + Intronic
1062072406 9:134563843-134563865 TGGGGTCTCCAGCTTGCAGATGG + Intergenic
1062183301 9:135202683-135202705 CAGGGTCTGAAGTTCTCAGATGG + Intergenic
1062214195 9:135380310-135380332 CCGGGCCTCCAGCTTGCCGATGG - Intergenic
1062745647 9:138210223-138210245 CTGGTTCTCCAGCTTGTAGACGG - Intergenic
1202791243 9_KI270719v1_random:91427-91449 CAGGGTCTCCAGGGTCCACAGGG - Intergenic
1185742656 X:2546331-2546353 CTGGTTCTCCAGCTTCCAGATGG - Intergenic
1185824505 X:3236917-3236939 CTGGGTCTCCAGCCTGCTGATGG - Intergenic
1185913667 X:4010364-4010386 CTGGGTCTCCAGCTTTCAGGTGG - Intergenic
1186140193 X:6563816-6563838 CTGAGTCTCCAGCTTGCAGATGG - Intergenic
1186283915 X:8023735-8023757 CTGGTCCTCCAGCTTGCAGATGG + Intergenic
1186313725 X:8346633-8346655 CTGGGTCTCCAGGCTGCAGAAGG + Intergenic
1186491584 X:9977755-9977777 CAAGGTCTCCAGCTTGCAGACGG - Intergenic
1186507409 X:10104111-10104133 CTGGGTCTCCGGCTTGCAGATGG - Intronic
1186662935 X:11687516-11687538 CAGGGACTCCAGCTCCCAGATGG + Intergenic
1186942171 X:14521565-14521587 CAGGGTGTCCAGCTTGCAGATGG + Intergenic
1187058528 X:15763731-15763753 CAGGGTCTCTGGCTTGCAGATGG - Intronic
1187060169 X:15779107-15779129 CTGGGTCTCCAGCTTGCAGATGG - Intronic
1187961025 X:24566427-24566449 CATGATCTCAAGTTTGTAGAAGG + Intronic
1188026768 X:25218092-25218114 CTGTGTCTTCAGCTTGCAGATGG + Intergenic
1188469843 X:30525839-30525861 TTGGGTCTCCAGGTTGCAGACGG - Intergenic
1188982224 X:36736632-36736654 CTGGGTTTCTAGTTTGCTGATGG + Intergenic
1189259064 X:39664874-39664896 CTTGTTCTCCAGCTTGCAGATGG - Intergenic
1189372124 X:40436877-40436899 CTGGGTCTCTAGCTTGCAGATGG + Intergenic
1189567791 X:42261332-42261354 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1189665788 X:43353366-43353388 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1189728211 X:43990189-43990211 CAGGGTCTGCAGCTTGCAGACGG + Intergenic
1189728386 X:43992735-43992757 CAGGGTCTGCAGCTTGCAGACGG - Intergenic
1189737382 X:44085805-44085827 CTGGGGCTCCAGCTTGCAGCCGG - Intergenic
1190255486 X:48759240-48759262 CTGGGTCTCCAGCTTGCTGATGG + Intergenic
1190507097 X:51137083-51137105 CAGGGTCTCCAGCCTGCAGATGG - Intergenic
1190689007 X:52898045-52898067 CAGGGTCTCATGTTTAGAGAGGG + Exonic
1190696976 X:52957747-52957769 CAGGGTCTCATGTTTAGAGAGGG - Intronic
1190701217 X:52991196-52991218 CTGGCTCTCCAGCTTGCAGATGG - Intronic
1191011156 X:55760926-55760948 CACTGTCTCCATTTTGAAGATGG + Intergenic
1191041457 X:56085325-56085347 CTGAGTCACCAGCTTGCAGATGG - Intergenic
1191630607 X:63317678-63317700 CAGGAACTCCAACTTGCAGATGG + Intergenic
1191631597 X:63327669-63327691 CAGGGTCTCCAGCTTGCAAATGG + Intergenic
1192419360 X:71015242-71015264 TGGGGTCTCCAGCTTGCAGATGG - Intergenic
1192440002 X:71167322-71167344 GAGGGTCTCAAGTTTGTGGAAGG + Exonic
1192592856 X:72375372-72375394 CTTGGACTCCGGTTTGCAGATGG - Intronic
1192743928 X:73920001-73920023 CTGGGTCTCCAGCTTGCAGATGG + Intergenic
1192743939 X:73920114-73920136 CTGGGTCTCCAGCTTGCAGTTGG - Intergenic
1192896617 X:75449112-75449134 CTGATTCTCCAGCTTGCAGATGG + Intronic
1193235407 X:79100615-79100637 TTGGGTCTCCAGCTTGTAGATGG + Intergenic
1193254412 X:79330157-79330179 CAGGGACTCTCCTTTGCAGAGGG - Intergenic
1193345596 X:80400030-80400052 CAGGATCTCCAGCTTGCAGAAGG - Intronic
1193376336 X:80766318-80766340 CTGGGTCTTCAGCTTGCAGATGG + Intronic
1194116256 X:89902113-89902135 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1194140410 X:90202429-90202451 TTGGTTCTCCAGCTTGCAGATGG - Intergenic
1194212361 X:91083602-91083624 CAGTGTCTCAAGGTTGCACAGGG + Intergenic
1194560810 X:95417276-95417298 CTGGCTCTCCAGCTTGCAGGTGG + Intergenic
1194659915 X:96619190-96619212 CAGGGTCTTCAGCTTTCAGATGG + Intergenic
1194793670 X:98183072-98183094 CAGGGTCTCTAGCTTGCAGATGG - Intergenic
1194870983 X:99130608-99130630 CAGGTTCTCCAGCTTACACATGG + Intergenic
1194970945 X:100343223-100343245 CTGGTTCTCCACCTTGCAGATGG + Intronic
1196213559 X:113023737-113023759 CCAGGTCTCCAGTTTGCCCATGG - Intergenic
1196226439 X:113172796-113172818 CAGTTTCTCCAGCTTTCAGATGG + Intergenic
1196821281 X:119703203-119703225 CCTGGTCTCCAGGTTGCAGATGG - Intergenic
1196894656 X:120323010-120323032 CTGGGTCTCCAGCTTGCAGATGG - Intergenic
1197486537 X:127057743-127057765 CTAGTTCTCCAGCTTGCAGAGGG + Intergenic
1197755053 X:129987584-129987606 CAGTGTTTCCAGTCTGCAGGTGG + Intronic
1197881808 X:131174591-131174613 CTGGTTCTCCAGCTTGCAGGTGG - Intergenic
1198058404 X:133018788-133018810 CTGGGCCTCCAGTTTGCAGATGG - Intergenic
1198066751 X:133105552-133105574 CTGGGTCTCCAGCTTACAGATGG + Intergenic
1198344557 X:135746884-135746906 GAGTGACTCCAGTTTGCATAAGG + Intergenic
1198527405 X:137515612-137515634 CTGATTCTTCAGTTTGCAGATGG + Intergenic
1198617751 X:138478133-138478155 AATGGACTCCAGTTTGCAGAGGG + Intergenic
1198708649 X:139477227-139477249 CGGGATCTCCAGCTTGCAGATGG + Intergenic
1198838532 X:140831386-140831408 CTGGTTCTCCAGTTTGTAGGTGG - Intergenic
1198851680 X:140970896-140970918 CAGGTTTTCCAGGTTGTAGAAGG - Intergenic
1198971605 X:142287006-142287028 CTGGGTCTTCTGCTTGCAGATGG + Intergenic
1199004556 X:142680119-142680141 CTGGTTCTCCAGTTTGCAGATGG - Intergenic
1199010806 X:142756304-142756326 CTAGGTCTCCAGCTTGCAGATGG + Intergenic
1199209944 X:145196044-145196066 CTGAGTCTCCAGCTTGCAGATGG + Intergenic
1199259584 X:145756074-145756096 CTGGCTCTCCAGCCTGCAGAGGG - Intergenic
1199371422 X:147054335-147054357 CTAGATCTCCAGCTTGCAGATGG - Intergenic
1199436074 X:147814267-147814289 CAGGGTCTTCAGCTTGCAGATGG - Intergenic
1199572316 X:149279275-149279297 CTGGGTCTCCAGCTTGTAGATGG + Intergenic
1199580989 X:149359644-149359666 CTGGGCTTCCAGCTTGCAGATGG - Intergenic
1199945220 X:152659954-152659976 TTGGCTCTCCAGTTTGCAGATGG - Intergenic
1200123349 X:153801694-153801716 CAAGGTGCTCAGTTTGCAGAAGG - Intergenic
1200469056 Y:3559238-3559260 CTGGTTCTCCAGTTTGCAGATGG + Intergenic
1200486155 Y:3771397-3771419 TTGGTTCTCCAGCTTGCAGATGG - Intergenic
1201152347 Y:11101085-11101107 CAGGGTCTCCAGTGTCCACAGGG + Intergenic
1201254818 Y:12096898-12096920 CTGGGTCTCCAGCTTGCAGGTGG + Intergenic