ID: 1109143910

View in Genome Browser
Species Human (GRCh38)
Location 13:58752247-58752269
Sequence TAAGTGGGCTGAGGCTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109143902_1109143910 25 Left 1109143902 13:58752199-58752221 CCCAAAGCATAACAGAAACTGGG 0: 1
1: 0
2: 0
3: 15
4: 224
Right 1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG No data
1109143906_1109143910 -6 Left 1109143906 13:58752230-58752252 CCATTTTTTACTGGCAGTAAGTG 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG No data
1109143899_1109143910 27 Left 1109143899 13:58752197-58752219 CCCCCAAAGCATAACAGAAACTG 0: 1
1: 0
2: 1
3: 16
4: 290
Right 1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG No data
1109143900_1109143910 26 Left 1109143900 13:58752198-58752220 CCCCAAAGCATAACAGAAACTGG 0: 1
1: 0
2: 1
3: 21
4: 323
Right 1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG No data
1109143904_1109143910 24 Left 1109143904 13:58752200-58752222 CCAAAGCATAACAGAAACTGGGT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109143910 Original CRISPR TAAGTGGGCTGAGGCTGATG TGG Intergenic
No off target data available for this crispr