ID: 1109145066

View in Genome Browser
Species Human (GRCh38)
Location 13:58769216-58769238
Sequence ATCTGATGATATGGTTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109145066_1109145069 16 Left 1109145066 13:58769216-58769238 CCATAATAACCATATCATCAGAT No data
Right 1109145069 13:58769255-58769277 AATTTCCAGTCAGATATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109145066 Original CRISPR ATCTGATGATATGGTTATTA TGG (reversed) Intergenic
No off target data available for this crispr