ID: 1109146226

View in Genome Browser
Species Human (GRCh38)
Location 13:58783072-58783094
Sequence AGAGTTCAGATCATCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109146226_1109146227 -10 Left 1109146226 13:58783072-58783094 CCAATATAGATGATCTGAACTCT No data
Right 1109146227 13:58783085-58783107 TCTGAACTCTAGTTCTTGTCAGG No data
1109146226_1109146228 -9 Left 1109146226 13:58783072-58783094 CCAATATAGATGATCTGAACTCT No data
Right 1109146228 13:58783086-58783108 CTGAACTCTAGTTCTTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109146226 Original CRISPR AGAGTTCAGATCATCTATAT TGG (reversed) Intergenic
No off target data available for this crispr