ID: 1109155851

View in Genome Browser
Species Human (GRCh38)
Location 13:58907808-58907830
Sequence CTGCTTTATTTGTTCAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109155849_1109155851 2 Left 1109155849 13:58907783-58907805 CCATTCAGATTTAGGTTATTTAA No data
Right 1109155851 13:58907808-58907830 CTGCTTTATTTGTTCAAATCAGG No data
1109155847_1109155851 8 Left 1109155847 13:58907777-58907799 CCCAATCCATTCAGATTTAGGTT No data
Right 1109155851 13:58907808-58907830 CTGCTTTATTTGTTCAAATCAGG No data
1109155848_1109155851 7 Left 1109155848 13:58907778-58907800 CCAATCCATTCAGATTTAGGTTA No data
Right 1109155851 13:58907808-58907830 CTGCTTTATTTGTTCAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109155851 Original CRISPR CTGCTTTATTTGTTCAAATC AGG Intergenic
No off target data available for this crispr