ID: 1109155938

View in Genome Browser
Species Human (GRCh38)
Location 13:58909489-58909511
Sequence GGGTGATCTAAGTTGCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109155938_1109155942 17 Left 1109155938 13:58909489-58909511 CCTTCTAGCAACTTAGATCACCC No data
Right 1109155942 13:58909529-58909551 CATAAAAATGTAAGACCAAGTGG No data
1109155938_1109155943 26 Left 1109155938 13:58909489-58909511 CCTTCTAGCAACTTAGATCACCC No data
Right 1109155943 13:58909538-58909560 GTAAGACCAAGTGGCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109155938 Original CRISPR GGGTGATCTAAGTTGCTAGA AGG (reversed) Intergenic
No off target data available for this crispr