ID: 1109157197

View in Genome Browser
Species Human (GRCh38)
Location 13:58925690-58925712
Sequence TTCTATATATAAAGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109157197_1109157199 4 Left 1109157197 13:58925690-58925712 CCTGGATGCCTTTATATATAGAA No data
Right 1109157199 13:58925717-58925739 ATCATAATCAACAGTTAGCAAGG No data
1109157197_1109157200 5 Left 1109157197 13:58925690-58925712 CCTGGATGCCTTTATATATAGAA No data
Right 1109157200 13:58925718-58925740 TCATAATCAACAGTTAGCAAGGG No data
1109157197_1109157201 6 Left 1109157197 13:58925690-58925712 CCTGGATGCCTTTATATATAGAA No data
Right 1109157201 13:58925719-58925741 CATAATCAACAGTTAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109157197 Original CRISPR TTCTATATATAAAGGCATCC AGG (reversed) Intergenic
No off target data available for this crispr