ID: 1109157788

View in Genome Browser
Species Human (GRCh38)
Location 13:58932654-58932676
Sequence AAGTTCTTCTAGAAAAGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109157788_1109157789 -10 Left 1109157788 13:58932654-58932676 CCTTAACTTTTCTAGAAGAACTT No data
Right 1109157789 13:58932667-58932689 AGAAGAACTTTATGACTAAATGG No data
1109157788_1109157792 25 Left 1109157788 13:58932654-58932676 CCTTAACTTTTCTAGAAGAACTT No data
Right 1109157792 13:58932702-58932724 AGAAATTATACTAATTAATGTGG No data
1109157788_1109157790 2 Left 1109157788 13:58932654-58932676 CCTTAACTTTTCTAGAAGAACTT No data
Right 1109157790 13:58932679-58932701 TGACTAAATGGTCACCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109157788 Original CRISPR AAGTTCTTCTAGAAAAGTTA AGG (reversed) Intergenic
No off target data available for this crispr