ID: 1109163550

View in Genome Browser
Species Human (GRCh38)
Location 13:59005421-59005443
Sequence GTGTGTGTGTGTAAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109163550_1109163555 14 Left 1109163550 13:59005421-59005443 CCCACTCCCTTACACACACACAC No data
Right 1109163555 13:59005458-59005480 ACACATTTTAATCTGGCATATGG No data
1109163550_1109163554 7 Left 1109163550 13:59005421-59005443 CCCACTCCCTTACACACACACAC No data
Right 1109163554 13:59005451-59005473 CACACACACACATTTTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109163550 Original CRISPR GTGTGTGTGTGTAAGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr