ID: 1109167937

View in Genome Browser
Species Human (GRCh38)
Location 13:59058960-59058982
Sequence ATGTAGAATGGGAATGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1109167933_1109167937 19 Left 1109167933 13:59058918-59058940 CCTAGTACATCAGTGTTTAGAGA No data
Right 1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1109167937 Original CRISPR ATGTAGAATGGGAATGAAGA CGG Intergenic
No off target data available for this crispr